%PDF-1.5 % 1 0 obj << /Matrix [1 0 0 1 0 0] /Subtype /Form /Filter /FlateDecode /Length 117 /Resources << /ExtGState << /GS0 2 0 R >> /XObject << /Fm1 3 0 R /Fm0 4 0 R >> >> /FormType 1 /Type /XObject /BBox [0 0 595 842] >> stream Hw,*LKL.Q.M*,HUO,I-M,V $g%d)98+prZX( gjlg Iw6PH/w5Pp r B /"6 endstream endobj 2 0 obj << /ca 1.0 /CA 1.0 /Type /ExtGState >> endobj 3 0 obj << /BBox [108.0 72.0 487.0 770.0] /Resources << >> /Matrix [1.0 0.0 0.0 1.0 0.0 0.0] /FormType 1 /Filter /FlateDecode /Subtype /Form /LastModified 5 0 R /Length 10 /PieceInfo 6 0 R /Type /XObject >> stream H0 endstream endobj 4 0 obj << /BBox [0.0 0.0 98.25 72.0] /Resources << /XObject << /Im0 7 0 R >> /ProcSet [/PDF /ImageC] >> /Matrix [1.0 0.0 0.0 1.0 0.0 0.0] /Subtype /Form /LastModified (D:20180620145913+08'00') /Length 44 /OC 8 0 R /Group 9 0 R /PieceInfo << /ADBE_CompoundType << /LastModified (D:20180620145913+08'00') /Private /Watermark /DocSettings 10 0 R >> >> /Type /XObject >> stream q 98.25 0 0 44.25 0 13.8800049 cm /Im0 Do Q endstream endobj 5 0 obj (D:20180620065813Z) endobj 6 0 obj << /PDFWP 11 0 R >> endobj 7 0 obj << /Width 131 /BitsPerComponent 8 /Name /X /Height 59 /Filter /DCTDecode /Subtype /Image /Length 4022 /ColorSpace /DeviceRGB /Metadata 12 0 R /Type /XObject >> stream JFIF``JFIF``ExifMM*>J?ZQQ Q z%u0`:oC      C  ;" }!1AQa"q2#BR$3br %&'()*456789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz w!1AQaq"2B #3Rbr $4%&'()*56789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz ?(;OOS=&հH ,@'k#:gXwmXp"i?t WT]J+cKeGe X8I8Z q` _ oٯBm2ؒrmG`FBrF+}Gèj:t֎E[d-{@XQL2xmxCq٧EPEP?QZkCjrNLdǣ?{W^H+JX:xmFDz5*$,l9>PѷXX>k}xWm✬`2? w |om8sSbYrBhcxWK|,emXTu 8N>7}_Z'4IusTOZ Ԯ8Hff `?/[{PA &hs$$@ߎ?:, kO鳇Sk[{Ӣ+05Ϗ&|3}Nּ&y2p\}vG̡3 ~4oHcF%ކ4y "߼y2ਞ;@]>dєıHPc>S Koqi$*wlzҾ?4%>5ͬ";,3H[\8$gW)w *<-k}z4S"Yxd]Ʋ8fs94ayl!r8dn@lld[?O%>dcbܤE{fVS_mآtk"nﳳA{¾&o>_-)';cw4f9!7ɦAQ!cPK1ʩrk~)ψGj:7`~N_|c5Rb\]$G@{xsRI\#)A},^Z[)e2vbI# zǁ;}$vPyK4\j<<֥PEPEcǚO}Mj:z1Uy"gh$O^Fp6f@dV\@o` uѯ!6^dT*;+O^>, z}sakyuy5&@LQF2I=:W<;zBf.mᾚ -̑˳-q\ŏdC*ilS1cCoj&$}5&xAO&kŷJf"/AT|wS.gxn;qox\,޲K!n /u&g_jzV7o4Y&41dA) !w8w[K[{7K՜zt-eoE( z֥iovZ6i],sU)mO_ _LJf:G~=wu$F15Wm|9_,3x}Ѩ]LZ,t6ʧv$]w?~"N?4~ֶؽ~(qߊ??ߋ5zLmōË=*&O4`-9'ľ'\xZ, kvR[ۨ|:.TQۊ Op|Sm=S2Э-UF>\$FvKG)_^3OYn<}JRx[Oc2SB~l hnv?77Wԣ-sf<k<k|?A.|IXGi%HTF2$e!jލ⏆:9u&⛝Zil⶛mfOMý_ u_mFwW2ji/鹛& (? endstream endobj 8 0 obj << /OCGs 13 0 R /Type /OCMD >> endobj 9 0 obj << /K true /Type /Group /S /Transparency >> endobj 10 0 obj << /Filter /FlateDecode /Length 274 >> stream HdPj0 ~{dBaPh7v53Kl(ݫG+L($??;^ZHNJD+tƗUxy/6Zm8!mF;25*z*ԊA8PwB,eɣg8oH>03 {fz>L֝=)xj5Vk[FYZwOs.e%ŃbcFő! 85(J^IqW2Oe4`87 endstream endobj 11 0 obj << /LastModified 5 0 R /Private 14 0 R >> endobj 12 0 obj << /Subtype /XML /Length 319 /Type /Metadata >> stream endstream endobj 13 0 obj << /Name (Background) /Type /OCG /Usage << /PageElement << /Subtype /BG >> /View << /ViewState /ON >> /Print << /PrintState /ON >> /Export << /ExportState /ON >> >> >> endobj 14 0 obj << /Flow 15 0 R >> endobj 15 0 obj (DefaultFlow) endobj 16 0 obj << /Filter /FlateDecode /Length 10 >> stream x+| endstream endobj 17 0 obj << /Filter /FlateDecode /Length 50 >> stream xS**T0г47S0A[(iK endstream endobj 18 0 obj << /Filter /FlateDecode /Length 10 >> stream x+| endstream endobj 19 0 obj << /Filter /FlateDecode /Length 50 >> stream xS**T0г47S0A[(iB endstream endobj 20 0 obj << /Filter /FlateDecode /Length 10 >> stream x+| endstream endobj 21 0 obj << /Filter /FlateDecode /Length 50 >> stream xS**T0г47S0A[(i0 endstream endobj 22 0 obj << /Filter /FlateDecode /Length 10 >> stream x+| endstream endobj 23 0 obj << /Filter /FlateDecode /Length 50 >> stream xS**T0г47S0A[(i9 endstream endobj 24 0 obj << /MarkInfo << /Marked true >> /Outlines 25 0 R /Lang (zh-CN) /Pages 26 0 R /StructTreeRoot 27 0 R /Type /Catalog >> endobj 26 0 obj << /Kids [28 0 R 29 0 R 30 0 R 31 0 R] /Count 4 /Type /Pages >> endobj 28 0 obj << /Group << /CS /DeviceRGB /Type /Group /S /Transparency >> /StructParents 0 /Parent 26 0 R /MediaBox [0 0 595.2 841.8] /Resources << /XObject << /Xi0 1 0 R >> /Font << /F2 32 0 R /F1 33 0 R /F6 34 0 R /F5 35 0 R /F4 36 0 R /F3 37 0 R >> /ProcSet [/PDF /Text /ImageB /ImageC /ImageI] >> /Tabs /S /Contents [20 0 R 38 0 R 21 0 R] /Type /Page >> endobj 38 0 obj << /Filter /FlateDecode /Length 4033 >> stream x\[,~_0ǁG²0}CLNȃC0$࿟*]zZ})6gTU4{˧?z~~t "_s씺|I\~7za@I}󟞟&w.0ɍ0Rط" XuTgB]rTN%7EiӅZ,4? eC|= *]Z+ Yk-8vrct'V1q{L0Vsl;WO/oj '}POoUb\dN-l ׏ZU?a28n"R ~ k5VMe}SŮyd'/֢Q́a'+t?id(`Cm}@R\' =j4A9%f6zl^06>O71̭NSa^]Kt_Y6~"Lt7D胘t[/l {'pe-efbt71`vBU !|#^@! b/e nUˤ9_@1 +"#DU`D"#:~fiKXp2ji*d\:u ۠()KR~4B+&y `n2 K %p5- x*M_.rqʒ>U%ztdl* NJ&7$˜^[QV>0LOcBz/ʃ>~}<<\Hos@)Q\M"C )Ah*Q=F>mNՄrg5uA>d f`UZ6(E6ԡ3f fhD:Yhl~+z52%; Q#G0zT@c#M Rn`:/ґ%Kj>#S3!j[7F#hZjLTTZjcy-q] W@?6W4lZ%5aQh\mxmS(:^h1_}#gX7r--A\"#l|~r;cט\bs~J.*a}5._vy^jz@І0JU3bBe:o\SvTM][W%wON=\ )VJOv(` Ro/`F892U(re^𚮡r!Mp+f]QnS+-h]کuCl)Z;ך RM}\{6)bn xsxDIsB @P[2q*<’lב&q ڑ&|{҈,.P-JBy}TtV/6Kn8zVP{AnRjM$-0҉0܄͘趎 U*۫/OizT^t[suɥ_+F!RmT _ Bx?Ƶ_\$9%w߷8t[6넝AhԢw;x'u.b-˾[!֡y#)vBm;K ||RXbRRRrqxg{S˸͸CQ* }fQ9e1=uD (Zg#>&1^,K-DwZhXQ!N"ERJoRC VW|%"/5"xOeסhbNGz&@8Zjo LNP6QvM2DP۰-Qz[w}%JhG"RAI*¤5 _ʴ4*\V'>Ϫ<;gp4klqAh-'C'>+J0ŠXx0K4EצyMq|;XlhgOk3M]Rq%n\YSv@p{=$JU~ԐE^ ћ k&;5=waKT8u.nQn.M]+=5q'D[bn 9mj"f9Fc3]|V&&;Pظ=E K EP.^Dɡ3򊦸eTr*扲YbN~MrhWm;Ə滱mIi@m;vFn-l滰6;mƀn=؍= 57c(f 6 ez$*gYsc!)uytJB uxйQu>$$η&-IX>Mmscus:0,u:1Ywv+)5Us]d (QgD,Wi*ET %҉D*hiã^;رdP树!푀=f,JLQeqA6OxSf2%& UagUv"wNа*+c$⃝VhXaeI6ҁixYF"6a4fCU(' endstream endobj 33 0 obj << /DescendantFonts 39 0 R /BaseFont /ABCDEE+#cb#ce#cc#e5 /Subtype /Type0 /ToUnicode 40 0 R /Encoding /Identity-H /Type /Font >> endobj 39 0 obj [41 0 R] endobj 41 0 obj << /BaseFont /ABCDEE+#cb#ce#cc#e5 /CIDSystemInfo 42 0 R /DW 1000 /Subtype /CIDFontType2 /FontDescriptor 43 0 R /W 44 0 R /CIDToGIDMap /Identity /Type /Font >> endobj 42 0 obj << /Supplement 0 /Registry (Adobe) /Ordering (Identity) >> endobj 43 0 obj << /FontName /ABCDEE+#cb#ce#cc#e5 /StemV 50 /FontFile2 45 0 R /Leading 141 /Ascent 859 /Flags 32 /FontWeight 400 /XHeight 250 /AvgWidth 500 /Descent -141 /ItalicAngle 0 /MaxWidth 1008 /FontBBox [-8 -141 1000 859] /Type /FontDescriptor /CapHeight 859 >> endobj 32 0 obj << /FirstChar 32 /Encoding /WinAnsiEncoding /Name /F2 /FontDescriptor 46 0 R /BaseFont /ABCDEE+#cb#ce#cc#e5 /Subtype /TrueType /LastChar 119 /Widths 47 0 R /Type /Font >> endobj 46 0 obj << /FontName /ABCDEE+#cb#ce#cc#e5 /StemV 50 /FontFile2 48 0 R /Leading 141 /Ascent 859 /Flags 32 /FontWeight 400 /XHeight 250 /AvgWidth 500 /Descent -141 /ItalicAngle 0 /MaxWidth 1008 /FontBBox [-8 -141 1000 859] /Type /FontDescriptor /CapHeight 859 >> endobj 37 0 obj << /FirstChar 32 /Encoding /WinAnsiEncoding /Name /F3 /FontDescriptor 49 0 R /BaseFont /ABCDEE+Calibri,Bold /Subtype /TrueType /LastChar 32 /Widths 50 0 R /Type /Font >> endobj 49 0 obj << /FontName /ABCDEE+Calibri,Bold /StemV 53 /FontFile2 51 0 R /Ascent 750 /Flags 32 /FontWeight 700 /XHeight 250 /AvgWidth 536 /Descent -250 /ItalicAngle 0 /MaxWidth 1759 /FontBBox [-519 -250 1240 750] /Type /FontDescriptor /CapHeight 750 >> endobj 36 0 obj << /DescendantFonts 52 0 R /BaseFont /ABCDEE+#bb#aa#ce#c4#d0#c2#ce#ba /Subtype /Type0 /ToUnicode 53 0 R /Encoding /Identity-H /Type /Font >> endobj 52 0 obj [54 0 R] endobj 54 0 obj << /BaseFont /ABCDEE+#bb#aa#ce#c4#d0#c2#ce#ba /CIDSystemInfo 55 0 R /DW 1000 /Subtype /CIDFontType2 /FontDescriptor 56 0 R /W 57 0 R /CIDToGIDMap /Identity /Type /Font >> endobj 55 0 obj << /Supplement 0 /Registry (Adobe) /Ordering (Identity) >> endobj 56 0 obj << /FontName /ABCDEE+#bb#aa#ce#c4#d0#c2#ce#ba /StemV 42 /FontFile2 58 0 R /Leading 19 /Ascent 800 /Flags 32 /FontWeight 400 /XHeight 250 /AvgWidth 429 /Descent -200 /ItalicAngle 0 /MaxWidth 1046 /FontBBox [-26 -200 1020 800] /Type /FontDescriptor /CapHeight 800 >> endobj 35 0 obj << /FirstChar 32 /Encoding /WinAnsiEncoding /Name /F5 /FontDescriptor 59 0 R /BaseFont /ABCDEE+#bb#aa#ce#c4#d0#c2#ce#ba /Subtype /TrueType /LastChar 32 /Widths 60 0 R /Type /Font >> endobj 59 0 obj << /FontName /ABCDEE+#bb#aa#ce#c4#d0#c2#ce#ba /StemV 42 /FontFile2 61 0 R /Leading 19 /Ascent 800 /Flags 32 /FontWeight 400 /XHeight 250 /AvgWidth 429 /Descent -200 /ItalicAngle 0 /MaxWidth 1046 /FontBBox [-26 -200 1020 800] /Type /FontDescriptor /CapHeight 800 >> endobj 34 0 obj << /FirstChar 32 /Encoding /WinAnsiEncoding /Name /F6 /FontDescriptor 62 0 R /BaseFont /ABCDEE+Calibri /Subtype /TrueType /LastChar 56 /Widths 63 0 R /Type /Font >> endobj 62 0 obj << /FontName /ABCDEE+Calibri /StemV 52 /FontFile2 64 0 R /Ascent 750 /Flags 32 /FontWeight 400 /XHeight 250 /AvgWidth 521 /Descent -250 /ItalicAngle 0 /MaxWidth 1743 /FontBBox [-503 -250 1240 750] /Type /FontDescriptor /CapHeight 750 >> endobj 29 0 obj << /Group << /CS /DeviceRGB /Type /Group /S /Transparency >> /StructParents 1 /Parent 26 0 R /MediaBox [0 0 595.2 841.8] /Resources << /XObject << /Xi1 1 0 R >> /Font << /F2 32 0 R /F1 33 0 R /F7 65 0 R /F6 34 0 R >> /ProcSet [/PDF /Text /ImageB /ImageC /ImageI] >> /Tabs /S /Contents [22 0 R 66 0 R 23 0 R] /Type /Page >> endobj 66 0 obj << /Filter /FlateDecode /Length 4277 >> stream x\݋$?a m_ CB.!O1/鮮Runls{jIRI? H?)7HN?~7_>~8}w{}=]׽7_~e;} 91N`d~.& Wx?~!RxL^ lCӧY/ӱA.EvLǿ߿|zB|sw iHmv}(z[eY6:=c,Hxgsdcsv1.ݷfz(]}"TL{5t&ZuUvؚ"#QjIl::f`-P ?}ӽjBXOWkX^#w+)RHbXX7؅| b3X%ޯ(8Q >Ei#Rz$A E>i44r;E l]_Y8r3A4vIwtfR]#!9eDɼ$QR'[XN =,#ñfBh+_ˈvn#WH̍\-?eP ѽ,e%1;Jڢ.F)0|gii4fi0wU \ŕna92R#.UiĴƴEo{Gaga_A~:]S.|5\@`ݕff`mKFsf&;O@z?R䥶 y,[.Ntl*zHRjOU$N=&24&T9l{h7E2[SU͛Q8 ʒ&2t_dA᠁V+ϘzOnmġ>wO[ͶO[(Oܤh}(mMl9_,hnY5$iCH6$dT&IYc n`ͩa6mmJLWˆRA2&MrF' c5gyAEQiG"tImmnMe(6VBJh΄kϊ1RN]dψbS9RNcu5J;: QdީmEKW.ǵtתlO?qy"wPs'F4u*6JLU,}rZ5>VdӳX= Q)$6EkS|]m'9xCv1(Q;6LvrzDI$?fՠ[2\L5yl3<]!B[Bm-չ =aa!S1-\W[-DךÈ>zIdg1{5Tw|X|.{>V4w Fdyh)d8|,7c""S._UFk9-dN$x4ւm<Yd%"3YrI*g^pVJ$fzt,U4ԪB\LCjΈa,Ha3%l-TE4=Y-˖f~m+]DȽ^Hx1$'9 ɭ>x./{1^Zccr9]_e/t JkR7.gwVޭ\5No@3v;G\`rOwA%Zi׷U[r=)fnKK童o̜? +knUɘH;d<́E+;9Zƌٙ[?5#tsw#ͥ:rm $CHpD ϒ\**y>RIQRUUXJI:J*QMCm?#;Kh;S,uGǸ@?5Q # WM@& ,W#RwΜ4.<_9Ԙ#HeUż|g^yYΜKLM` ِd.r\`s2X5>]&P̯gn~\GL74ʰWho)G6)#[kr-OtJJRii|fa:Ӭl|d,0@Uj1@&EL`j(xA9PYz9Y:W^QM58J7# ay'"+)7w V\&ă[ tJ7D*{pl{}+jK ^Ζ_-r|5db!-I&)׮mW#B\^wz~9ՒKw৖"N_ ƽy% sБw5b`GOw x} 8eZ7Bz#`(t$RJ"":w c@<,h} <7t5iyezjWX>gOi6#D tiefb,::d(a|.,5,W\ޖ7%P;mzit/@8qJ]Y)gh&Y;9YBmp_:E.@ݶ5V%s"-JX }ݳ^.g"M˙h"gM;a߄IC^u=Xp :cE?Ȧ [ $č%ܮ̽27=9)u/8S7]{Pf?|rO m*:g>J=u?Aoy;;z Þg7 t"j昛7{ dm/s,9K} |B:PxԋSs…X pf{>N 8JHt`ĎfHV z<ɥ2:> endobj 67 0 obj << /FontName /Times#20New#20Roman /StemV 40 /Leading 42 /Ascent 891 /Flags 32 /FontWeight 400 /XHeight 250 /AvgWidth 401 /Descent -216 /ItalicAngle 0 /MaxWidth 2568 /FontBBox [-568 -216 2000 693] /Type /FontDescriptor /CapHeight 693 >> endobj 30 0 obj << /Group << /CS /DeviceRGB /Type /Group /S /Transparency >> /StructParents 2 /Parent 26 0 R /MediaBox [0 0 595.2 841.8] /Resources << /XObject << /Xi2 1 0 R >> /Font << /F2 32 0 R /F1 33 0 R >> /ProcSet [/PDF /Text /ImageB /ImageC /ImageI] >> /Tabs /S /Contents [18 0 R 69 0 R 19 0 R] /Type /Page >> endobj 69 0 obj << /Filter /FlateDecode /Length 2139 >> stream xYI7AqsXU\FZ1 lb流E =o>բƿM~i///@R;oQu_俿|}8mHվ'r?OFҸ,}tcX *gB|};<q{cq{mY"3 Gc`< !4Le;j:z˰3Eg:D'!@A&ru▨t^[eavb83z nawͫu pQQ8Yna|8 >zrM-NRʝEȸPF  ,To`k[HP:GO怷 =hB7MA=+˖{G4-]MP}7 @lgrx$[LvD295L $R rc)OSFYznq\t0*S ә9]DK EL1✘l+RbBb#\33*<0Ԉ`D 3^xYWE&߬gdƎL‹K:wK>m,Acyub3f ~Cs52;3᲏Iu8+U25~fL1uY0,M ͪ:hKC48 oj9rE( kGM7&>?  N#+0w\4D%>'DXHieNDhTlvo /Ku% p=>-?A2D&d$N41z˖,#cr1Z dɳ9ܳKNCe55ЦwRht1|޵2 o9|HyYN 8ח_Rplu l3+ЄlsPZGP^lh`Bz]ΓQHgЏ=MPYRٵ9b.M{Rm MJK!T9p,+2&hmӉ2Ӥi7@Oy1aunRʮ]:-4wTK$䐠O^ͭ-?s:}S[pT;Z`K~cq<4j9V Q@܁E`$ CD% rӅE=oq$e`ض@MZEUZ2#P}XڅTg`IMj_eքK\ҜXoΎ̬[Ֆ!:#3 \.t5gA$\/.7(om5%2(Dxrڶo`pjږfPSyهโUAm,-oQg9'?m&Nw x7ňGD ,N{^*S#yzR_4V'MӾUY(!QbypuY<.֠G t :h,q 7l;ֶxF;؜}jܯacL1 endstream endobj 31 0 obj << /Group << /CS /DeviceRGB /Type /Group /S /Transparency >> /StructParents 3 /Parent 26 0 R /MediaBox [0 0 595.2 841.8] /Resources << /XObject << /Xi3 1 0 R >> /Font << /F2 32 0 R /F1 33 0 R >> /ProcSet [/PDF /Text /ImageB /ImageC /ImageI] >> /Tabs /S /Contents [16 0 R 70 0 R 17 0 R] /Type /Page >> endobj 70 0 obj << /Filter /FlateDecode /Length 287 >> stream xK@gdAg(ZXNѡCMEF#)~LJОcM aØ"S] 0-, yv0! cƬMFVZ[EZcs=&N$"QDh9Q#q`/C~D@۲yߣ[ h:Ol,^eĵ+E'ήN(/D% j&ڕ1/vdCZ2F2F%#˺  endstream endobj 25 0 obj << /First 71 0 R /Type /Outlines /Last 72 0 R >> endobj 71 0 obj << /Title (N0e^8QsTNfWg,`Q) /Parent 25 0 R /Dest [28 0 R /XYZ 87 558 0] /Next 73 0 R >> endobj 73 0 obj << /Title (N0QsTNN~TQsTQs|) /Parent 25 0 R /Dest [29 0 R /XYZ 87 577 0] /Next 74 0 R /Prev 71 0 R >> endobj 74 0 obj << /Title (N\t0QsTNfN;Q[) /Parent 25 0 R /Dest [29 0 R /XYZ 87 111 0] /Next 75 0 R /Prev 73 0 R >> endobj 75 0 obj << /Title (\bN\tQsTNfN;Q[) /Parent 25 0 R /Dest [30 0 R /XYZ 87 763 0] /Next 76 0 R /Prev 74 0 R >> endobj 76 0 obj << /Title (\bN\tQsTNfSO{~r`Q) /Parent 25 0 R /Dest [30 0 R /XYZ 87 623 0] /Next 77 0 R /Prev 75 0 R >> endobj 77 0 obj << /Title (V0QsTNfvvT[QlS_qT) /Parent 25 0 R /Dest [30 0 R /XYZ 87 553 0] /Next 78 0 R /Prev 76 0 R >> endobj 78 0 obj << /Title (N0rz˄cNNRMSSrza) /Parent 25 0 R /Dest [30 0 R /XYZ 87 413 0] /Next 72 0 R /Prev 77 0 R >> endobj 72 0 obj << /Title (Qm0YgeN) /Parent 25 0 R /Dest [30 0 R /XYZ 87 180 0] /Prev 78 0 R >> endobj 27 0 obj << /ParentTree 79 0 R /RoleMap 80 0 R /ParentTreeNextKey 4 /K [81 0 R] /Type /StructTreeRoot >> endobj 80 0 obj << /Diagram /Figure /Header /Sect /Worksheet /Part /Footer /Sect /InlineShape /Sect /Slide /Part /Footnote /Note /Annotation /Sect /Chart /Sect /Dialogsheet /Part /Endnote /Note /Artifact /Sect /Chartsheet /Part /Workbook /Document /Macrosheet /Part /Textbox /Sect >> endobj 79 0 obj << /Nums [0 82 0 R 1 83 0 R 2 84 0 R 3 85 0 R] >> endobj 81 0 obj << /P 27 0 R /K [86 0 R 87 0 R 88 0 R 89 0 R 90 0 R 91 0 R 92 0 R 93 0 R 94 0 R 95 0 R 96 0 R 97 0 R 98 0 R 99 0 R 100 0 R 101 0 R 102 0 R 103 0 R 104 0 R 105 0 R 106 0 R 107 0 R 108 0 R 109 0 R 110 0 R 111 0 R 112 0 R 113 0 R 114 0 R 115 0 R 116 0 R 117 0 R 118 0 R 119 0 R 120 0 R 121 0 R 122 0 R 123 0 R 124 0 R 125 0 R 126 0 R 127 0 R 128 0 R 129 0 R 130 0 R 131 0 R 132 0 R 133 0 R 134 0 R 135 0 R 136 0 R 137 0 R] /Type /StructElem /S /Sect >> endobj 86 0 obj << /Pg 28 0 R /P 81 0 R /K [0 1 2 3 4 5 6 7 8] /Type /StructElem /S /P >> endobj 82 0 obj [86 0 R 86 0 R 86 0 R 86 0 R 86 0 R 86 0 R 86 0 R 86 0 R 86 0 R 87 0 R 88 0 R 88 0 R 89 0 R 89 0 R 90 0 R 91 0 R 91 0 R 92 0 R 93 0 R 93 0 R 94 0 R 94 0 R 95 0 R 95 0 R 95 0 R 95 0 R 95 0 R 95 0 R 95 0 R 95 0 R 95 0 R 95 0 R 95 0 R 95 0 R 95 0 R 95 0 R 95 0 R 95 0 R 95 0 R 95 0 R 95 0 R 95 0 R 95 0 R 95 0 R 95 0 R 95 0 R 95 0 R 95 0 R 95 0 R 96 0 R 96 0 R 97 0 R 97 0 R 98 0 R 98 0 R 98 0 R 98 0 R 98 0 R 98 0 R 98 0 R 98 0 R 98 0 R 98 0 R 98 0 R 99 0 R 100 0 R 100 0 R 101 0 R 101 0 R 138 0 R 139 0 R 139 0 R 139 0 R 139 0 R 140 0 R 141 0 R 141 0 R 141 0 R 142 0 R 143 0 R 143 0 R 143 0 R 143 0 R 144 0 R 145 0 R 145 0 R 145 0 R 146 0 R 147 0 R 147 0 R 147 0 R 147 0 R 148 0 R 149 0 R 149 0 R 149 0 R 149 0 R 150 0 R 151 0 R 151 0 R 151 0 R 151 0 R 152 0 R 153 0 R 153 0 R 154 0 R 154 0 R 155 0 R 155 0 R 156 0 R 156 0 R 157 0 R 158 0 R 159 0 R 160 0 R 161 0 R 161 0 R 162 0 R 162 0 R 163 0 R 164 0 R 165 0 R 166 0 R] endobj 87 0 obj << /Pg 28 0 R /P 81 0 R /K [9] /Type /StructElem /S /P >> endobj 88 0 obj << /Pg 28 0 R /P 81 0 R /K [10 11] /Type /StructElem /S /P >> endobj 89 0 obj << /Pg 28 0 R /P 81 0 R /K [12 13] /Type /StructElem /S /P >> endobj 90 0 obj << /Pg 28 0 R /P 81 0 R /K [14] /Type /StructElem /S /P >> endobj 91 0 obj << /Pg 28 0 R /P 81 0 R /K [15 16] /Type /StructElem /S /P >> endobj 92 0 obj << /Pg 28 0 R /P 81 0 R /K [17] /Type /StructElem /S /P >> endobj 93 0 obj << /Pg 28 0 R /P 81 0 R /K [18 19] /Type /StructElem /S /H1 >> endobj 94 0 obj << /Pg 28 0 R /P 81 0 R /K [20 21] /Type /StructElem /S /P >> endobj 95 0 obj << /Pg 28 0 R /P 81 0 R /K [22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48] /Type /StructElem /S /P >> endobj 96 0 obj << /Pg 28 0 R /P 81 0 R /K [49 50] /Type /StructElem /S /P >> endobj 97 0 obj << /Pg 28 0 R /P 81 0 R /K [51 52] /Type /StructElem /S /P >> endobj 98 0 obj << /Pg 28 0 R /P 81 0 R /K [53 54 55 56 57 58 59 60 61 62 63] /Type /StructElem /S /P >> endobj 99 0 obj << /Pg 28 0 R /P 81 0 R /K [64] /Type /StructElem /S /P >> endobj 100 0 obj << /Pg 28 0 R /P 81 0 R /K [65 66] /Type /StructElem /S /P >> endobj 101 0 obj << /Pg 28 0 R /P 81 0 R /K [67 68] /Type /StructElem /S /P >> endobj 102 0 obj << /Pg 28 0 R /P 81 0 R /K [167 0 R 168 0 R 169 0 R] /Type /StructElem /S /Table >> endobj 167 0 obj << /Pg 28 0 R /P 102 0 R /K [170 0 R 171 0 R 172 0 R 173 0 R 174 0 R 175 0 R 176 0 R 152 0 R] /Type /StructElem /S /TR >> endobj 170 0 obj << /Pg 28 0 R /P 167 0 R /K [138 0 R 139 0 R] /Type /StructElem /S /TD >> endobj 138 0 obj << /Pg 28 0 R /P 170 0 R /K 69 /Type /StructElem /S /Span >> endobj 139 0 obj << /Pg 28 0 R /P 170 0 R /K [70 71 72 73] /Type /StructElem /S /P >> endobj 171 0 obj << /Pg 28 0 R /P 167 0 R /K [140 0 R 141 0 R] /Type /StructElem /S /TD >> endobj 140 0 obj << /Pg 28 0 R /P 171 0 R /K 74 /Type /StructElem /S /Span >> endobj 141 0 obj << /Pg 28 0 R /P 171 0 R /K [75 76 77] /Type /StructElem /S /P >> endobj 172 0 obj << /Pg 28 0 R /P 167 0 R /K [142 0 R 143 0 R] /Type /StructElem /S /TD >> endobj 142 0 obj << /Pg 28 0 R /P 172 0 R /K 78 /Type /StructElem /S /Span >> endobj 143 0 obj << /Pg 28 0 R /P 172 0 R /K [79 80 81 82] /Type /StructElem /S /P >> endobj 173 0 obj << /Pg 28 0 R /P 167 0 R /K [144 0 R 145 0 R] /Type /StructElem /S /TD >> endobj 144 0 obj << /Pg 28 0 R /P 173 0 R /K 83 /Type /StructElem /S /Span >> endobj 145 0 obj << /Pg 28 0 R /P 173 0 R /K [84 85 86] /Type /StructElem /S /P >> endobj 174 0 obj << /Pg 28 0 R /P 167 0 R /K [146 0 R 147 0 R] /Type /StructElem /S /TD >> endobj 146 0 obj << /Pg 28 0 R /P 174 0 R /K 87 /Type /StructElem /S /Span >> endobj 147 0 obj << /Pg 28 0 R /P 174 0 R /K [88 89 90 91] /Type /StructElem /S /P >> endobj 175 0 obj << /Pg 28 0 R /P 167 0 R /K [148 0 R 149 0 R] /Type /StructElem /S /TD >> endobj 148 0 obj << /Pg 28 0 R /P 175 0 R /K 92 /Type /StructElem /S /Span >> endobj 149 0 obj << /Pg 28 0 R /P 175 0 R /K [93 94 95 96] /Type /StructElem /S /P >> endobj 176 0 obj << /Pg 28 0 R /P 167 0 R /K [150 0 R 151 0 R] /Type /StructElem /S /TD >> endobj 150 0 obj << /Pg 28 0 R /P 176 0 R /K 97 /Type /StructElem /S /Span >> endobj 151 0 obj << /Pg 28 0 R /P 176 0 R /K [98 99 100 101] /Type /StructElem /S /P >> endobj 152 0 obj << /Pg 28 0 R /P 167 0 R /K 102 /Type /StructElem /S /Span >> endobj 168 0 obj << /Pg 28 0 R /P 102 0 R /K [177 0 R 178 0 R 179 0 R 180 0 R 181 0 R 182 0 R 183 0 R 160 0 R] /Type /StructElem /S /TR >> endobj 177 0 obj << /Pg 28 0 R /P 168 0 R /K [153 0 R] /Type /StructElem /S /TD >> endobj 153 0 obj << /Pg 28 0 R /P 177 0 R /K [103 104] /Type /StructElem /S /P >> endobj 178 0 obj << /Pg 28 0 R /P 168 0 R /K [154 0 R] /Type /StructElem /S /TD >> endobj 154 0 obj << /Pg 28 0 R /P 178 0 R /K [105 106] /Type /StructElem /S /P >> endobj 179 0 obj << /Pg 28 0 R /P 168 0 R /K [155 0 R] /Type /StructElem /S /TD >> endobj 155 0 obj << /Pg 28 0 R /P 179 0 R /K [107 108] /Type /StructElem /S /P >> endobj 180 0 obj << /Pg 28 0 R /P 168 0 R /K [156 0 R] /Type /StructElem /S /TD >> endobj 156 0 obj << /Pg 28 0 R /P 180 0 R /K [109 110] /Type /StructElem /S /P >> endobj 181 0 obj << /Pg 28 0 R /P 168 0 R /K [157 0 R] /Type /StructElem /S /TD >> endobj 157 0 obj << /Pg 28 0 R /P 181 0 R /K [111] /Type /StructElem /S /P >> endobj 182 0 obj << /Pg 28 0 R /P 168 0 R /K [158 0 R] /Type /StructElem /S /TD >> endobj 158 0 obj << /Pg 28 0 R /P 182 0 R /K [112] /Type /StructElem /S /P >> endobj 183 0 obj << /Pg 28 0 R /P 168 0 R /K [159 0 R] /Type /StructElem /S /TD >> endobj 159 0 obj << /Pg 28 0 R /P 183 0 R /K [113] /Type /StructElem /S /P >> endobj 160 0 obj << /Pg 28 0 R /P 168 0 R /K 114 /Type /StructElem /S /Span >> endobj 169 0 obj << /Pg 28 0 R /P 102 0 R /K [184 0 R 185 0 R 186 0 R 187 0 R 188 0 R 189 0 R 190 0 R 166 0 R] /Type /StructElem /S /TR >> endobj 184 0 obj << /Pg 28 0 R /P 169 0 R /K [] /Type /StructElem /S /TD >> endobj 185 0 obj << /Pg 28 0 R /P 169 0 R /K [161 0 R] /Type /StructElem /S /TD >> endobj 161 0 obj << /Pg 28 0 R /P 185 0 R /K [115 116] /Type /StructElem /S /P >> endobj 186 0 obj << /Pg 28 0 R /P 169 0 R /K [162 0 R] /Type /StructElem /S /TD >> endobj 162 0 obj << /Pg 28 0 R /P 186 0 R /K [117 118] /Type /StructElem /S /P >> endobj 187 0 obj << /Pg 28 0 R /P 169 0 R /K [] /Type /StructElem /S /TD >> endobj 188 0 obj << /Pg 28 0 R /P 169 0 R /K [163 0 R] /Type /StructElem /S /TD >> endobj 163 0 obj << /Pg 28 0 R /P 188 0 R /K [119] /Type /StructElem /S /P >> endobj 189 0 obj << /Pg 28 0 R /P 169 0 R /K [164 0 R] /Type /StructElem /S /TD >> endobj 164 0 obj << /Pg 28 0 R /P 189 0 R /K [120] /Type /StructElem /S /P >> endobj 190 0 obj << /Pg 28 0 R /P 169 0 R /K [165 0 R] /Type /StructElem /S /TD >> endobj 165 0 obj << /Pg 28 0 R /P 190 0 R /K [121] /Type /StructElem /S /P >> endobj 166 0 obj << /Pg 28 0 R /P 169 0 R /K 122 /Type /StructElem /S /Span >> endobj 103 0 obj << /Pg 29 0 R /P 81 0 R /K [191 0 R 192 0 R 193 0 R 194 0 R 195 0 R] /Type /StructElem /S /Table >> endobj 191 0 obj << /Pg 29 0 R /P 103 0 R /K [196 0 R 197 0 R 198 0 R 199 0 R 200 0 R 201 0 R 202 0 R 203 0 R] /Type /StructElem /S /TR >> endobj 196 0 obj << /Pg 29 0 R /P 191 0 R /K [] /Type /StructElem /S /TD >> endobj 197 0 obj << /Pg 29 0 R /P 191 0 R /K [204 0 R] /Type /StructElem /S /TD >> endobj 204 0 obj << /Pg 29 0 R /P 197 0 R /K [0 1] /Type /StructElem /S /P >> endobj 83 0 obj [204 0 R 204 0 R 205 0 R 206 0 R 207 0 R 208 0 R 203 0 R 209 0 R 209 0 R 210 0 R 210 0 R 211 0 R 211 0 R 212 0 R 212 0 R 213 0 R 214 0 R 215 0 R 216 0 R 217 0 R 217 0 R 218 0 R 218 0 R 219 0 R 219 0 R 220 0 R 220 0 R 221 0 R 222 0 R 223 0 R 224 0 R 225 0 R 226 0 R 226 0 R 227 0 R 228 0 R 229 0 R 230 0 R 231 0 R 232 0 R 233 0 R 234 0 R 234 0 R 235 0 R 236 0 R 237 0 R 238 0 R 239 0 R 240 0 R 104 0 R 104 0 R 105 0 R 105 0 R 106 0 R 106 0 R 106 0 R 106 0 R 106 0 R 106 0 R 106 0 R 106 0 R 106 0 R 106 0 R 106 0 R 106 0 R 106 0 R 106 0 R 106 0 R 106 0 R 106 0 R 106 0 R 106 0 R 106 0 R 106 0 R 107 0 R 107 0 R 107 0 R 107 0 R 107 0 R 107 0 R 108 0 R 108 0 R 108 0 R 108 0 R 108 0 R 108 0 R 108 0 R 108 0 R 108 0 R 108 0 R 108 0 R 108 0 R 108 0 R 108 0 R 108 0 R 108 0 R 108 0 R 108 0 R 108 0 R 108 0 R 108 0 R 109 0 R 109 0 R 109 0 R 109 0 R 109 0 R 109 0 R 109 0 R 109 0 R 109 0 R 109 0 R 109 0 R 109 0 R 109 0 R 109 0 R 109 0 R 109 0 R 109 0 R 109 0 R 109 0 R 109 0 R 109 0 R 109 0 R 109 0 R 110 0 R 110 0 R 111 0 R 111 0 R 111 0 R 111 0 R 111 0 R 111 0 R 111 0 R 111 0 R 111 0 R 111 0 R 112 0 R 112 0 R 113 0 R 113 0 R 114 0 R 115 0 R 115 0 R] endobj 198 0 obj << /Pg 29 0 R /P 191 0 R /K [205 0 R] /Type /StructElem /S /TD >> endobj 205 0 obj << /Pg 29 0 R /P 198 0 R /K [2] /Type /StructElem /S /P >> endobj 199 0 obj << /Pg 29 0 R /P 191 0 R /K [] /Type /StructElem /S /TD >> endobj 200 0 obj << /Pg 29 0 R /P 191 0 R /K [206 0 R] /Type /StructElem /S /TD >> endobj 206 0 obj << /Pg 29 0 R /P 200 0 R /K [3] /Type /StructElem /S /P >> endobj 201 0 obj << /Pg 29 0 R /P 191 0 R /K [207 0 R] /Type /StructElem /S /TD >> endobj 207 0 obj << /Pg 29 0 R /P 201 0 R /K [4] /Type /StructElem /S /P >> endobj 202 0 obj << /Pg 29 0 R /P 191 0 R /K [208 0 R] /Type /StructElem /S /TD >> endobj 208 0 obj << /Pg 29 0 R /P 202 0 R /K [5] /Type /StructElem /S /P >> endobj 203 0 obj << /Pg 29 0 R /P 191 0 R /K 6 /Type /StructElem /S /Span >> endobj 192 0 obj << /Pg 29 0 R /P 103 0 R /K [241 0 R 242 0 R 243 0 R 244 0 R 245 0 R 246 0 R 247 0 R 216 0 R] /Type /StructElem /S /TR >> endobj 241 0 obj << /Pg 29 0 R /P 192 0 R /K [209 0 R] /Type /StructElem /S /TD >> endobj 209 0 obj << /Pg 29 0 R /P 241 0 R /K [7 8] /Type /StructElem /S /P >> endobj 242 0 obj << /Pg 29 0 R /P 192 0 R /K [210 0 R] /Type /StructElem /S /TD >> endobj 210 0 obj << /Pg 29 0 R /P 242 0 R /K [9 10] /Type /StructElem /S /P >> endobj 243 0 obj << /Pg 29 0 R /P 192 0 R /K [211 0 R] /Type /StructElem /S /TD >> endobj 211 0 obj << /Pg 29 0 R /P 243 0 R /K [11 12] /Type /StructElem /S /P >> endobj 244 0 obj << /Pg 29 0 R /P 192 0 R /K [212 0 R] /Type /StructElem /S /TD >> endobj 212 0 obj << /Pg 29 0 R /P 244 0 R /K [13 14] /Type /StructElem /S /P >> endobj 245 0 obj << /Pg 29 0 R /P 192 0 R /K [213 0 R] /Type /StructElem /S /TD >> endobj 213 0 obj << /Pg 29 0 R /P 245 0 R /K [15] /Type /StructElem /S /P >> endobj 246 0 obj << /Pg 29 0 R /P 192 0 R /K [214 0 R] /Type /StructElem /S /TD >> endobj 214 0 obj << /Pg 29 0 R /P 246 0 R /K [16] /Type /StructElem /S /P >> endobj 247 0 obj << /Pg 29 0 R /P 192 0 R /K [215 0 R] /Type /StructElem /S /TD >> endobj 215 0 obj << /Pg 29 0 R /P 247 0 R /K [17] /Type /StructElem /S /P >> endobj 216 0 obj << /Pg 29 0 R /P 192 0 R /K 18 /Type /StructElem /S /Span >> endobj 193 0 obj << /Pg 29 0 R /P 103 0 R /K [248 0 R 249 0 R 250 0 R 251 0 R 252 0 R 253 0 R 254 0 R 224 0 R] /Type /StructElem /S /TR >> endobj 248 0 obj << /Pg 29 0 R /P 193 0 R /K [217 0 R] /Type /StructElem /S /TD >> endobj 217 0 obj << /Pg 29 0 R /P 248 0 R /K [19 20] /Type /StructElem /S /P >> endobj 249 0 obj << /Pg 29 0 R /P 193 0 R /K [218 0 R] /Type /StructElem /S /TD >> endobj 218 0 obj << /Pg 29 0 R /P 249 0 R /K [21 22] /Type /StructElem /S /P >> endobj 250 0 obj << /Pg 29 0 R /P 193 0 R /K [219 0 R] /Type /StructElem /S /TD >> endobj 219 0 obj << /Pg 29 0 R /P 250 0 R /K [23 24] /Type /StructElem /S /P >> endobj 251 0 obj << /Pg 29 0 R /P 193 0 R /K [220 0 R] /Type /StructElem /S /TD >> endobj 220 0 obj << /Pg 29 0 R /P 251 0 R /K [25 26] /Type /StructElem /S /P >> endobj 252 0 obj << /Pg 29 0 R /P 193 0 R /K [221 0 R] /Type /StructElem /S /TD >> endobj 221 0 obj << /Pg 29 0 R /P 252 0 R /K [27] /Type /StructElem /S /P >> endobj 253 0 obj << /Pg 29 0 R /P 193 0 R /K [222 0 R] /Type /StructElem /S /TD >> endobj 222 0 obj << /Pg 29 0 R /P 253 0 R /K [28] /Type /StructElem /S /P >> endobj 254 0 obj << /Pg 29 0 R /P 193 0 R /K [223 0 R] /Type /StructElem /S /TD >> endobj 223 0 obj << /Pg 29 0 R /P 254 0 R /K [29] /Type /StructElem /S /P >> endobj 224 0 obj << /Pg 29 0 R /P 193 0 R /K 30 /Type /StructElem /S /Span >> endobj 194 0 obj << /Pg 29 0 R /P 103 0 R /K [255 0 R 256 0 R 257 0 R 258 0 R 259 0 R 260 0 R 261 0 R 232 0 R] /Type /StructElem /S /TR >> endobj 255 0 obj << /Pg 29 0 R /P 194 0 R /K [225 0 R] /Type /StructElem /S /TD >> endobj 225 0 obj << /Pg 29 0 R /P 255 0 R /K [31] /Type /StructElem /S /P >> endobj 256 0 obj << /Pg 29 0 R /P 194 0 R /K [226 0 R] /Type /StructElem /S /TD >> endobj 226 0 obj << /Pg 29 0 R /P 256 0 R /K [32 33] /Type /StructElem /S /P >> endobj 257 0 obj << /Pg 29 0 R /P 194 0 R /K [227 0 R] /Type /StructElem /S /TD >> endobj 227 0 obj << /Pg 29 0 R /P 257 0 R /K [34] /Type /StructElem /S /P >> endobj 258 0 obj << /Pg 29 0 R /P 194 0 R /K [228 0 R] /Type /StructElem /S /TD >> endobj 228 0 obj << /Pg 29 0 R /P 258 0 R /K [35] /Type /StructElem /S /P >> endobj 259 0 obj << /Pg 29 0 R /P 194 0 R /K [229 0 R] /Type /StructElem /S /TD >> endobj 229 0 obj << /Pg 29 0 R /P 259 0 R /K [36] /Type /StructElem /S /P >> endobj 260 0 obj << /Pg 29 0 R /P 194 0 R /K [230 0 R] /Type /StructElem /S /TD >> endobj 230 0 obj << /Pg 29 0 R /P 260 0 R /K [37] /Type /StructElem /S /P >> endobj 261 0 obj << /Pg 29 0 R /P 194 0 R /K [231 0 R] /Type /StructElem /S /TD >> endobj 231 0 obj << /Pg 29 0 R /P 261 0 R /K [38] /Type /StructElem /S /P >> endobj 232 0 obj << /Pg 29 0 R /P 194 0 R /K 39 /Type /StructElem /S /Span >> endobj 195 0 obj << /Pg 29 0 R /P 103 0 R /K [262 0 R 263 0 R 264 0 R 265 0 R 266 0 R 267 0 R 268 0 R 240 0 R] /Type /StructElem /S /TR >> endobj 262 0 obj << /Pg 29 0 R /P 195 0 R /K [233 0 R] /Type /StructElem /S /TD >> endobj 233 0 obj << /Pg 29 0 R /P 262 0 R /K [40] /Type /StructElem /S /P >> endobj 263 0 obj << /Pg 29 0 R /P 195 0 R /K [234 0 R] /Type /StructElem /S /TD >> endobj 234 0 obj << /Pg 29 0 R /P 263 0 R /K [41 42] /Type /StructElem /S /P >> endobj 264 0 obj << /Pg 29 0 R /P 195 0 R /K [235 0 R] /Type /StructElem /S /TD >> endobj 235 0 obj << /Pg 29 0 R /P 264 0 R /K [43] /Type /StructElem /S /P >> endobj 265 0 obj << /Pg 29 0 R /P 195 0 R /K [236 0 R] /Type /StructElem /S /TD >> endobj 236 0 obj << /Pg 29 0 R /P 265 0 R /K [44] /Type /StructElem /S /P >> endobj 266 0 obj << /Pg 29 0 R /P 195 0 R /K [237 0 R] /Type /StructElem /S /TD >> endobj 237 0 obj << /Pg 29 0 R /P 266 0 R /K [45] /Type /StructElem /S /P >> endobj 267 0 obj << /Pg 29 0 R /P 195 0 R /K [238 0 R] /Type /StructElem /S /TD >> endobj 238 0 obj << /Pg 29 0 R /P 267 0 R /K [46] /Type /StructElem /S /P >> endobj 268 0 obj << /Pg 29 0 R /P 195 0 R /K [239 0 R] /Type /StructElem /S /TD >> endobj 239 0 obj << /Pg 29 0 R /P 268 0 R /K [47] /Type /StructElem /S /P >> endobj 240 0 obj << /Pg 29 0 R /P 195 0 R /K 48 /Type /StructElem /S /Span >> endobj 104 0 obj << /Pg 29 0 R /P 81 0 R /K [49 50] /Type /StructElem /S /H1 >> endobj 105 0 obj << /Pg 29 0 R /P 81 0 R /K [51 52] /Type /StructElem /S /P >> endobj 106 0 obj << /Pg 29 0 R /P 81 0 R /K [53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73] /Type /StructElem /S /P >> endobj 107 0 obj << /Pg 29 0 R /P 81 0 R /K [74 75 76 77 78 79] /Type /StructElem /S /P >> endobj 108 0 obj << /Pg 29 0 R /P 81 0 R /K [80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100] /Type /StructElem /S /P >> endobj 109 0 obj << /Pg 29 0 R /P 81 0 R /K [101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123] /Type /StructElem /S /P >> endobj 110 0 obj << /Pg 29 0 R /P 81 0 R /K [124 125] /Type /StructElem /S /P >> endobj 111 0 obj << /Pg 29 0 R /P 81 0 R /K [126 127 128 129 130 131 132 133 134 135] /Type /StructElem /S /P >> endobj 112 0 obj << /Pg 29 0 R /P 81 0 R /K [136 137] /Type /StructElem /S /P >> endobj 113 0 obj << /Pg 29 0 R /P 81 0 R /K [138 139] /Type /StructElem /S /P >> endobj 114 0 obj << /Pg 29 0 R /P 81 0 R /K [140] /Type /StructElem /S /P >> endobj 115 0 obj << /Pg 29 0 R /P 81 0 R /K [141 142] /Type /StructElem /S /H1 >> endobj 116 0 obj << /Pg 30 0 R /P 81 0 R /K [0 1] /Type /StructElem /S /H1 >> endobj 84 0 obj [116 0 R 116 0 R 117 0 R 117 0 R 117 0 R 117 0 R 117 0 R 117 0 R 118 0 R 118 0 R 119 0 R 119 0 R 119 0 R 120 0 R 120 0 R 121 0 R 122 0 R 122 0 R 123 0 R 123 0 R 124 0 R 125 0 R 125 0 R 126 0 R 126 0 R 127 0 R 127 0 R 127 0 R 127 0 R 127 0 R 127 0 R 127 0 R 127 0 R 127 0 R 127 0 R 127 0 R 127 0 R 127 0 R 127 0 R 127 0 R 127 0 R 127 0 R 127 0 R 127 0 R 127 0 R 127 0 R 127 0 R 127 0 R 127 0 R 127 0 R 127 0 R 127 0 R 128 0 R 128 0 R 129 0 R 130 0 R 130 0 R 131 0 R 131 0 R 132 0 R 132 0 R 132 0 R 132 0 R 132 0 R 132 0 R 132 0 R 133 0 R] endobj 117 0 obj << /Pg 30 0 R /P 81 0 R /K [2 3 4 5 6 7] /Type /StructElem /S /P >> endobj 118 0 obj << /Pg 30 0 R /P 81 0 R /K [8 9] /Type /StructElem /S /P >> endobj 119 0 obj << /Pg 30 0 R /P 81 0 R /K [10 11 12] /Type /StructElem /S /H1 >> endobj 120 0 obj << /Pg 30 0 R /P 81 0 R /K [13 14] /Type /StructElem /S /P >> endobj 121 0 obj << /Pg 30 0 R /P 81 0 R /K [15] /Type /StructElem /S /P >> endobj 122 0 obj << /Pg 30 0 R /P 81 0 R /K [16 17] /Type /StructElem /S /H1 >> endobj 123 0 obj << /Pg 30 0 R /P 81 0 R /K [18 19] /Type /StructElem /S /P >> endobj 124 0 obj << /Pg 30 0 R /P 81 0 R /K [20] /Type /StructElem /S /P >> endobj 125 0 obj << /Pg 30 0 R /P 81 0 R /K [21 22] /Type /StructElem /S /H1 >> endobj 126 0 obj << /Pg 30 0 R /P 81 0 R /K [23 24] /Type /StructElem /S /P >> endobj 127 0 obj << /Pg 30 0 R /P 81 0 R /K [25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51] /Type /StructElem /S /P >> endobj 128 0 obj << /Pg 30 0 R /P 81 0 R /K [52 53] /Type /StructElem /S /P >> endobj 129 0 obj << /Pg 30 0 R /P 81 0 R /K [54] /Type /StructElem /S /H1 >> endobj 130 0 obj << /Pg 30 0 R /P 81 0 R /K [55 56] /Type /StructElem /S /H1 >> endobj 131 0 obj << /Pg 30 0 R /P 81 0 R /K [57 58] /Type /StructElem /S /P >> endobj 132 0 obj << /Pg 30 0 R /P 81 0 R /K [59 60 61 62 63 64 65] /Type /StructElem /S /P >> endobj 133 0 obj << /Pg 30 0 R /P 81 0 R /K [66] /Type /StructElem /S /P >> endobj 134 0 obj << /Pg 31 0 R /P 81 0 R /K [0] /Type /StructElem /S /P >> endobj 85 0 obj [134 0 R 135 0 R 136 0 R 136 0 R 137 0 R 137 0 R 137 0 R 137 0 R 137 0 R 137 0 R 137 0 R] endobj 135 0 obj << /Pg 31 0 R /P 81 0 R /K [1] /Type /StructElem /S /P >> endobj 136 0 obj << /Pg 31 0 R /P 81 0 R /K [2 3] /Type /StructElem /S /P >> endobj 137 0 obj << /Pg 31 0 R /P 81 0 R /K [4 5 6 7 8 9 10] /Type /StructElem /S /P >> endobj 40 0 obj << /Filter /FlateDecode /Length 1988 >> stream xnz -'w0 4&E.' KǎXdygt9`7"FM{??_OwOo_?ݞ?>?\ys}wB͜Ƿӗ^}{sӏ_Oz_>L?/ݻӧ_ovti?~s'ۏӵzwxs{zy|zͿwo{wuz;0a7ޭms~~G@QwmyB:K9Ȣ=!mWE[c:9%QB{;\Jhn׏~쯬Vx5w.j"CluQwX(/+UJa9WX|M._Ht(NUqEaQ|'R pщ`HJ爯wyU.FGr8Ð^cip6lkx1hW7Q5ÖX357"'r,P P "|12GtK=Lҟ3ͫwHJrlPfǚvc d89 U#,,&Ie"Ct\L܉ݷWg)܆KSc)%%Qe| IR iiZʰP"Ydh"oH򐤑c\ir#OCotwM$ۼm /V]!&El Rjb&*:DHvC|㱉vG*=C# 9'EX}Xi悾FWYdRŘ5l?T1jyet+GyR#i\4D:ʍhacѩHjZhd%Tt3餧vwe>)=4991NIeSbRyCCMCH2"j"tR1I3Vc*pb)kM;E]{QRf3,uHgMr}yh-_l\|&lkBڿkm$eۮdQngN2I)O:6dcvQt"Ő<\g)pMy9# "EDm#)yhdRq@4^CD=DűƲ*@T;S2Py5^D6˚eloi*4D8vN!B,&jPbʎ5U3լ5IW[rRKh@$7pEYE]ECճ5Vn4\X6BikϡxFE&Xh\JeCwбCAc՛Y>˞7ss\X2k [ǖ3;č-%cB^/U tNJF&k?żV(&.yy^7Zg_Hzn:^{/]jth@T접\ypN YB_6^g ^}hО7K2Gi%ЦX% ʢ q$I W"-oi`ujDKCz>@LZ,LYEd?(Q2%Ʒ@׷OOg1r}8TqZ 96R endstream endobj 45 0 obj << /Filter /FlateDecode /Length 66890 /Length1 331796 >> stream x̝Knu׿9߷:ǽ۷o?6E`7cKB@$H b  1a"` L|޿?s0Ju޵Z^jULd2wdO8L_dRO?O_olZ}/ʿoMʯ>6L__}ys|oIW7_{_ܜ&7}?w<)G׿W翾gg6ϷyohR~o|/ҿ~䞿˓/W~?ؼΦϿW6{Lv7dwWW'冾y+/l~Ly_|tRys~K/VL&7>Z^aS|rοrL^dOּ3_t?K5N^+crd:ymR7.;{KW>?S?N7xܡaR}AP91)?"6eSf)FYn ǻ>nC^ؔŦnS˳Sڧ۔{6徨Sv7e'4D{nxh#X7 p?c?~;A*h\Fma8 Lc1iZ_*7AC|rS~zSܔ6ne?J7ߴR魭2}<{7pd䦼{S޷)ٔӛMMysߊs7xpߔ7mDԦ|>'6峛6M|lS>t}*ԾޔD{y!? <8JѾx~G|yG"r'xsʤƤV}dܙ?Q\iןѹ-R'^qUTr 9T{635ֶ^Կ:ֵdXs_zg7ױlYNtv(Z?gїE8W1֣xUq]L@r E2qE=/BV{!y ~>U`Ku2V?qtCWvXqWWm4W} 蔞~$pĵAۃeX?`֦Uh?(g{>,^ч|] An8Kw~0yIVsӸB22 p:ѣcL9p^?f<->_^h''Z:~ȣeXp?5>Ie*]m 398}Xn3϶xF:3\72=50>gūxzFkl]!~<.wZƱ;\(Y:1&tcu>AzODC_[k*k 7!ۋxfnp=2:R\K>N /snWwe,1ch\a,[۫2Y355CU \2յƨϿZ]=vb4w*ҟp/yk<wxg9X96wgQ^!Y-.x}-y42)`~c{h+ϖe,mNLٟ*IK6){d.u8ٚ<8{2NoxqJjy'΢͍Y\GǨ>?w~=~߇( < N1Gh{\~^m%7'O#պoNoE:v1뿾Yr~m;u+:(wjw&8,?o'V3_ϕZ8}#F!3ЮGNo#Ųž'eo2Im[㿣(͓_4 ū(CAlY1?Ox/x{mcOD2|g; pEr 5a}L|Y|⛊$CRk?Oԉ}M Cm%)1ݺ dU|x`8W!މ_9OHċ3ȆkOk+>zIp$yPtžgAlTO>J2OF?uKVv<G7y#%a}w%=iO ڞ(]./j\he3ҥLzś%OF)yV{)c;r8eng#w9^ؿh.<ˠ/#"mʘWᔋ1_9qTy_󡽗O?1ީw\ɼ }#9@X} ྌ=wi:*qZDuϹP5pXGi~T 6+9~X<>ýhw{7W<*y8ڶ:Ky3뜡u7*e]εs7pXpon}3pmuN8D:^O׬F:(=SgHVځy¹Zgpf֎k93h wp[v-c٤s`SV=m%˛&q-gdC=79'˳@snĩ;ʚc|g>eܗ|!a N.AE죽=qUS?}@d۱k#u,=L/D{U*^޹QWџ-9,cl(=\̘ s/\+ʂ^ i=C؉gJvF{`_<0;k]q }j{~\̀]g3z3I}dN: .}ts@fܣq*ɇ{ěٗwno7K ^ܗ?6TwpH'k]Sory8=>nj#2y<>ߩtxn ߕ:.ܞSz뱒eϱ\?oJ=W.}ϼJz}9Ul~C_'O8c@{d#v\:IJ4dG܋>(~V>{ACPLu'h{SUv-7p 6\_{U/6d[3 `2h۬IY<2lޯvDڤx<b(lNW62ֺ]!/?ueV]G{}_<^&C.Ü[\#Fi8H`kB}Wp`5V<~[yp2x^^jK-Ȁz~Nd{=ީi}xxeؔn^<j0W-j'pN-ό5SAs`>pMQx\=3>yl0+A&het iڡ?ry̾>y̬ךZ_ǵ@%\-P6'X ܓ?l/IcI6vNǸK%]i/ពaOku1-e_9ƹ[]࠯WS]N縦9c=5.ƨ܋pH'_ Y{3f>5ưD~)b$pxILG]u#8Aks鬗[,;eߗJdKz/~P#ԎgՏz*'^Ftz hv˰WP6;e3٪L~pT7]_g^|ΞY?9v6n.S^;Z0rpZ)dm][m~5~&dt'oh;ۖn`dm83ӿdȜ.KU>n^Zc.^dcԮ$4i7y'ﲵ%c׍n̯6ڶӱH8kq2dz> DOƇ-z˟6Jcgw`9^5s9~ޏP3YGkyLIގij\c'ޮh[fesʐS}oq}*E~uUmg׺nw'/ڢ^Nwꙹ}QS 9^٘kņ!_|ʱ>g`2s=t3i֜,nsr_2]pca~Im/9 _KrY.xn]Gkf2?gg}DLkQmn\#?szuctЧ8|arRMo: 3eq,F3Ӫmwo˯yqyeDg9,y拳i,tcقP_w]r_G+7B܆Ydk,99NAP}d ^?^|o0py 18>>\wIEcbؿ!Mw++oU'xU0ry%?P ] E.ߪ>FUNWqxϤ>mnWrV#$d/"(~S}X߇wʚŜ1G3]X{gbWx8ߐEkPOgYer^0bZ^>g>y$8HG'26P]ƟwٜgڻK\^wNoe|%:#ȘcZ΀O :qnCֶ/8ɗN~7y2[@y׿oտ}\״ 9Rn3)y/މ39H?>}. K)@d=]zֿm2 O G-Ѡ=2mg9qrߥlΓ̳v&>Uop\25dnj{z6_WG#H7msLkO1|ҥl :< E}we,Z):~7? {'(wcOU~[8NўŮZK2nQz5tU_,C^Gtvg[]'Wh1e i4g,,!>t2&v2&k1V"GMDzk2{vܬ?N`pm澗)[_erYtOf}91U٘+7poɒ|9c,[psy|ysNK>[4r6Y!*\IWUgu H=uׇ;I3_g:Q%QEmTO~7A(?U-q  .y']2+.d:ôϖ/q&>?92a0dzc9-QqN4e}xR#=Vߥי2|zmt (,I}uPPY捠Y.Gf}o.7>A_!^\t=/ZO=l>'}2;-_-'1B;rQU/tϵǬm{̓e7`<=yKޓwwMGHCwY%m|snp2eQgt}{jϔzTXIA_[9>e]{ *u1w_x>+ jNFg.h^槇֖|5?{^*0V}ovwzx&z0Yi㞕&N+>s;׾umq)88N`gZoス^v.. -S1=Y.uOx h'-|wNC,}ȶ2>;kRkN衐-<˿9z]uqq",~X WKo#WKV|znͿ~n>b.^e_vT6)9_|t6u})q:۠\9[zoh7 ;&T;B;G-I&msv OK:8G%.sg3G::˹ )ļϝyye{znHw Ξe>|,ȋ2'w)3~rYqpx؆-y)VKֿo_[O;XYl79|o'>YeLk! iӚmi߮KuҮK7^7G2|­+}g '}4іhz*zќ_F6s O| ֊xW乌>*q1qc];&ǣYO^X=uݟ'4k|;VYL~cxu:E}Pޗ0fI[3Y (36]bmk_Ƽemܧڜ$%;qM` ޳\`wQnKc]&7{[q=`OpIڞ/T+{Ϙpm}D<\,\,kҲsAnv%ǂ^rj}EyH񐷌痍C[%\3(z?\s?XwAG;q/J8dkSnaW"on}, PS g>~V9ɜ1 >VH״ j} .z}=vg^ Yk _Kz!=HG}ʵ 6bd8簮9V/_{c#ZJ6ܗcg;<_B=2e.}v={Ϲ__J:G/N>lcn3s8l#\?wV\+,b7XlTX֗sz~tm2u4Ws|OW1,S?WHy;i'z16<]OF7Vs7f2eyۛ t|oYl}>/[ƽ}nƟK]%uiU(qJW(}t33y3tI2]GVY<>/^Vū֜>+km.13|2pOhg>kXѝ4~&Һ]|rjK½>[S~uQ_.㻪xlK:2qA[_wfh]_aoɻ'}w>zz|9,7|\9sUt=x\C%λs{cl.Ee[;WޖJ^G2Ɉ|*ѥsTwSZ>CWIgM(wi3ܯ6G ~mw[~CY/s?`m+Eu;^/~wݍ6:ݧeeNU9fmpx8e:גCKf3efl1U]ly._/[L::8r\?_M[63gf#f0w-{.~[Y8;OY8l ˈS߸ Eo1̀g-U_[m*SCE|}(Ŀu.L ԪC}fWd,73; m$sio83& m7*y_Ɠ6x8[1q,Ww\SykV.p-ʵCdfgVk7q_F;*ܽka m_e?FU.Zڲ7/XY7ѷA͘UPz ZaǴlpf0sQ!k 87̓v~6}|lٗ379GDnGFŷ2LA5$yUk̵f<[ىϙmpORοfo} +_ g+๯Nr/n9}vրy{C;|:ύYN߇S2Oe38-!oߠ65`gs3vxBnZaeZƿki,~N-x@9Us_m;s{# mBdkg~~D0v';ؚD vJux眬T'ЕomJ9$g۸dl.|UiǶc9UZm7YӶ޼[+&ޓٺm{~۞36EsG/8o>Y̒:G%%2^ec#|dy>9lL$O٦׭9aaf}ۤc;Z{h໖"O]v]VNOYq]{0|N*?Cf?qjY>pʧl7]+WFԒq6e{jo^.њ\̋bWqȖ~qkǑNxoy8ٖkq͓qR}^Z)V\3:LZ8Nt)?{|/yXӭ[ Uʐ" 1 a`$L"~5vOEg?nnyjۦQ0IĎEHޞ9 {{|=^^{{apW{nV.X/KYv^"pQ܃^N[QڈJR#j,hL^)y;Sj({*ޯ5wtzT^?Jxs@7ԻW5i_PTL=Di>+:k-CvT{T~j6 zi'^zP>݋P{c}@WWc1 e_49n~D|fұx#G4yWQ{+l¹?8cO/h  8>Ī:$Vm|:4Pg(#w>ϪN)j^|U4'>*$/gao CN/<[g^<}^7͍c{/zc_#n6MVzqĴ69ےN P^;t1By s7h kB,+v8ƀqځ6o񶘽 [\FP贈7\KiY.K`e^"ps|׍8<QC;Ag`uivh'owv~'4 Yܛ+.\KSd7:npYhx(uo,&2[>nrw1XW0t!E,_ Ga?]-l0-Ծr񞠇⸻bxFCі^l._{wԭ#ᨛ7 7؞{f2)EE¦sp̎E;.xVAeB]]=>bc)Ŷ m/][noЋeT>B= kv.܎-*V {XVvv;(OEu >"sl iVpknmGn:F˾&gz{1:w]&|4X'`>>:H>Ygr(< FXǨxFlMAl 3x#q!.)h'O(ӹӽYhHGKgh,8rJ;Y +]- 6 ?f i)Am`X(~-]<p~0| $sX.Qhop~s_piu0^ipnĿAe^sc@N!^EP/D[hc٠c3Aa,{B [C9ƢtðT97],vbP/UqZ1^GlQ}bZ1i5򲛞\6? #_}qsixX\ش󿕱}SiOt[GNZy4PB˨ԕ{@f-A>(t/s\0Mc b9WEruTn=-.74_ؾ9هΟ9\STmC+h.9}&W@o>Ah~&l&=ܖ4 i ߘO@#5xPC+xwAu=DaN R%#' HKir'n#7 +Y,vH\*jרZk] BVF' gKUr5\@$;d+l!k}y;.f ʀ$a-d2Yc!CO8,숺6+ot㹡,-y*!٢%j:)HuEb!KD'.ݬzmeˋQ-J;Y Գ̬;+&j&*׶U\B.R%H}үF*Jp Pa;# =i0PU=F" XIx_3E[HθptX͕-`mVXH@4U4eg(nGbxV-&$p"ы(Qs&iC(JY5A?NYezU"o+u[|_"OYHg`}K\~%,|g n,QPp8c7Q+UDjg*k$Q/ǝL Y^,0%v)5W@][ɠK9O+G==%1|5^6NF 'P&J$JHjI}:v]ї-pfr!P?<"䊨Q_x:(}UUe*J^BHR)A=Ϲd^v|:pXL9r %=%ory3jŬ*ONǰv*Ge<r]&‚VVFeX}~$\nUcSck~/ru-,F(Y*˺MN+t7!b{GG7 Kò,Tm'-W(@B 2`8vMʟfRwxŠkfO<#ŵVRb%DWV0(AYY ;K % IAG ^d>` U@n8seVB.sUM 4Yb*g5\.}PqWc|Z}ϐH-,Wڊ,)V&qUJnFj[@ d\)YU\%$uqV&Wx3Pwiغ 3^[lZ*=$` }tüys*rQ(:ZuU$F?cVK*%$W'Gya-[{9dպr6dx3-f^@t҆ųhWmEuI1uu%!P0#[3q}m)g3[źQlex |)ʆWNu>J鴋kʤJ΄aTuY6.Gػ"V'SI_^`\*tZ҆J/a]G*u31U+}h!lkcE%VYVFSUW+ʇҊ?Yʪt*,J) j5Q>DyAמf&+fD-, t6uT`Q',@*9ܐ6Lg\aIg+Ϧ,i6V%i8ה`vJ|)]7 6쎾^*[<*syòXJI*k'޻8OIkW7]Rh"lN_Q^,ti,% xĈVj|,,?, xg:<)U~0I5U*(eQUe"ϡ } Z MBeznx,Pxxx|:BbYZRre 9GG.+n? ֕=ݒ:5)XzEV9y糛a΄~|/--lŊH]!aG)XWVP=^R1KP.7 YY}e&\@IOcb$ ϩTqR$|ˡ> xWrnc(iURb{./G3^B+#XuZ`dAY.As+]'D`\Lx*ub\& :mr[q:J[q’a1;Qa܋0((w %=cG*W{rΥ\,B|#ArEsPHX_̑|5V,dL$x#@p'jgAjD.$J*JH^S.x.yFX_.x,|f(+$kvRd:m*X;"^ޤqwGYiI,*֟K\E9~{$ ~G+7.:d^*'a̚Z9;r$G}X*> I,i(9LrϽ\dX/8pR+;3RQ x kQ1aXsO6?'}O9 [V>'# ?kKxBY+q3sfΪ,d8'sx{7OS b8`3@$mٍJrP7Z4 me?nh(\gumnZȪs{;y [};3 N,5: b{C,PUQEneK$+jW_ 1:d`Twӹwm8GYNNM|5wT"ϹrNw؉H925 S>~W\=a~upʑn5DJԛ,/;A<Y͞.:/ _P}xO#q0_ DW^&AsJL#N{-]ꗡH5DXP, G$ގ: sY[ee! @2KݩpL$1oV̼A_$2U(/wryJYN}@AhucSqpF0+VهO;)6_Cx _TaW F 󓝝2)M'Ur`İs:/H7TpedO^8%6 udiYC9yfdߝPu:suKpA;5(>_&YmO;1Z)JZ*>?#/`Z3j2̖3n":q2$NL3f" i,; f>GхAbNyR'lɿ` 81^rkGf"Tĺ(ct`hQG!EH7 )%2 ǀ |r2J2oȹTu3r(mbg~eyf"lI+л䝅FJwhƿ3Im>ٜ\6n򣓟eS˦VN}vCӟ=ӏL?>3}W؁2Ԙс# ~U`I2iLL3 0LҘ* >6UL;?p~^E GSϝ`_`,eᒅm g.,L/L)}k!-}W{{>B{?{oKvw_{~ƞ|'}W{\仞`=owom}ڷ?dc?-B8sn&O<]zzS]_u{xg~@oxl{7/g_xl}p[[ggi,N((`Er7*~{Wvm?#}J,tңhR7Ccz |9<Q&jWMT}1&K2r YNVc8`a%"dYMf,yYC#k9#=l$/'ȉ$4N&SitrcW,r69T*r>l%m5" %{hN.~\X{RۭjuR'SO˴h?~Kih~=F;?j/h?i/jymA'LFtM庡ۺ r1))y=A/5zE5N%G%oțț~}@oy/y6i-6By/eZҏǩ4MX:H'JmR[Ir>>@ߡߥчEծ1מvipދڢmlݲz˫\em[^-۷rj}Zv6=1m>M}^ИRӐRO6Ki!zD'-Lw҅| 6]扗ȦT! :q; h)xTjZ N6-c YEtp^3]l`x08Kqk`Xy3Cssϓg5k?=qXaZ,MeZ#CzQG^e;1t 2u,klިᒁA˚19J>ŬM+;T y 2rb8 Ɔ00ό^a<5lIy'#L93ټYjNl&|mlsl|y(]e#Uc|(]uzڭg-v1ک>e*yq☆i^IgLWlDȽl{t+W; a)8C׈k崔>[ȷUۭuI{ MԴºkp/rKi0?0{rپd=㚴iQ+Ռȯ&/dLVfMV92JLJVJٍˑʯ~|YlgVj^grҙ8{K.1.`+XVrSo9Lҁx%5.B<(>G$/F/ JI5h4^][9`ԏ8ʏQ_`gLLg7@GаnT'-k=+73|X&Դ8zS/9"2~ɌZmIBi5iwxeU΅bJ#F|& 4K|mCׯތJꮫӨ/T1*%ykIutu]O%'cƠ|MҺ]zKPY{:%mvlOe&9'-kkoi6jG9֓ d†7NYuѽEbݤiUK+m#.0qAɒAڪG=ZaS^)Fz%#֜Oitbxq\yq0QL6%HwLI,=c%qa7NU[7IMÜ^ϡed̰jS&uD)f183ɜ:RiaZ6U3hiؑĎ5_[^ҭsќ!7aeYoIޠ|A Vl c\;2@FHIu]^QLk=P2|ycP}1on_Uq_k:=޷qs愕4\73R%6WuR4ÒV##Wg#GVT>@WWц}84:ȉщ޸lW<{)kXV%bFu6F_efSv5ki` TO,fsTXr5NԜWT˵^Ϋsk8M&+LtʞR~QuxX|b\u} 8c. +==3Qr*S4g#}ӻa2a4Bxgй$Sdr:Fך]rzh9uiLhVfkSkX{|:L%3 `us𔬠A;MR4ZEt7`Pnjqxtxh$IMQi;Y)Fz:\?m#6Fj и`mhNd6gŬjLzUoV<ˮY+cF+h|As@?Vn֝i[aE7\%I?%Qq1qCX9sS\l=8_sN褸fG WZV6Jc2Mu^k_79ʥޜ_Yr9wtoƾ4J:=w8sϹP\]]=wWWu7IzBOy%$@8 6aeB8xBa,ʊ'?>JzUwWu眽}{[z졇% ?{)\O!I(2L L0#>7ζ|{ZdbA88j''T$u?y18tMJi\2Qc˶;-Jk N٪ν4vMVpJO(e%k84vPBN}aN5bLFvы1]ÜE9Gj ÜxmiOTmXIz0M]uC9^wg\r{^c z Mja}$nN+J)tPBNBpo h3~ȰS[ڴTտuŭ\T|Kp'ך9Bf" 10@9^{P%ax"RPi[-lU!aUMЮ齀R'U#!.O@uNje }%׃ضR:۴߭N{Z-ȝ}N!J%e ,S'*m8TS{S #m /u)tNc$ iҪ.f^~^w|4Xx7^o!4.{~T01:Ԟps oK-44%# Iʜ,89禂iE7jȉYJdXd0rÈ*aH3_㽪zm@jLg59[˔h rG$8[G-lN\bэ(1vD!C*ZQQdLN{\ ɨpW4  &: aM,]a),跩;S|-IZӤ%siҘ0},wLa/xۯJ,cii MbUI-|-N~v%aLGu#-n-H(4H/g0/Pbk1ҏ[ q\ 3i&CYg' ,+y D5v]}*tD[,u;Fg<%ȈLrb9BUwJ۹gvV'ͺ 售r "|Z-Nz26nOr?ⰘAJ_6r02hVݜ|Pe@C-i- 1pP# u-ߓqm"|ggZ8k"+iyuVwvχ^MR45e n60#LR~`1XpAòN }z%+1M7s;BlC8D.v;NžH3ԚD||"N'zONkO2dv=ȅz5~ l*9VFi9|gՊ5pR痤a (F4 l:-jpiV/$p:-Xc\j>-`]ƬujVͽC*#J Ң+~ >w‘i=ܿe0q(bq09)(?\3p/x-_^R8,lh:Smw'b t 1I;soKaoA\re!z@2g̼;۶a,MJlp^d]} KuV3י}f.*Z8pf*Fo}IbvVC\?s\LZb 3o˃9m>P證&xH^mMu#`V+j-4j@0\MƏ$*i^ }gYÌѱ+z r( FL@}p[%q"Щ m-ŸUMFZ5+XWyeP,^WfrU)e̷ юo/[CPĊR>*\c8>6pUn(;?=ptZw/þ|8U!m WghǍmf͈6;d8cN0 fsgz2$ >W)%{dWr*Um>83Ro["< Vhdr#^ẗ.rc-1|8BY6:Ė8K&iKOwb{w:;dkE\mDeFTJ=ciȬm2cp]ߧfm_sKzSgUkt촊wl!j' r賠;=jxo%SDQ M=+p,:,X. .ӹ,2B7uZ4U"}]=gEY\/eT\q1 EL:0w+'3WTB) W}PWm/ 0RnT%Rhϝ?B2lhq!h0`$^铘mfm4z . .gVy}9R1VM˫`Q& ѩZ]Fhԣ(ERiаY&nKg޽ak CXSZwGn+eFb"zʭ:m*(aGzt=@QGJ# Z9,6M%By)kDxKm5zg$ӵʉ_zG#쥊D7`Ws!$lpVbR~u,79kMBLU{+Q;dFScm6Ȍ&LAi8AD,w.[4bV~Lѻ m&SG&_8SRU!H=KմU 9dLMDn;Ѯc&Xڄw!ǦZt%P!CͰP[@B&"Wç4߭]*eG)yki:7HKc?dz,3>DP3V -Xż.OwH +C21ªCRpjP.qeJʼ2Py9NO_ε_+e\ÓX[v5ǷƼmCDRibڄk6p>a:eA^^wP-uea% ׯkũK-Y}-8$W6[5Ҩ/8ZS3֘d[7,tl7 ?ȼ:qq&ydKSkeVZV^Zto;= .,nؔ?b ]NapdONC*iNi>+ 4Uxk^tWvKN90AQQ\UWs|*k:H`.;A_ {' ȶ0&>`*R)k}E4$o^oQhWh V9k-R-FVJ,GX̖K;Q?}d5mpͺ}9p MGk'!օm]^0߱#k4s*I퐨uL"T|`&E=˕zD_5[Za:K6SZS={*u\g}--aӼ,5ńSژ44B7SCrjx#\Lz2c9 m;x? l-1'ƭx 3*v*>(@m?KZ1BImjEo肈!<-b@22aG (SgCjmzCޔ<6Jl 6`v7{C8քW~wRmY#m (u gFX[ܤW+1r iXyhXB铗>{x^QVYkN ƭeHLu:{hIxA?j{zT]-Al|gmluii9z# c Ȼߣ5qF:} u@%N üJ3_i̚{S[wA55+קY*Zwlh?s*pصqX.iUyw~O(\ &-5g^19fU\I<z&*(a:unK3~eQv4$K~T~rێnvөY 2j0Ӳ)ѿ'Qas|=|CGh25ぃlޑ5Gf8񹍞4qm->xb9j0- !S!v7 0uL)ʑ=,f.o zT_ud{=?yA&\,5HhQ Rn\ͯ 4GÚ iXID%IE7iU}?߷hqE}CY=h`}BFɨUD9påE`yrљ[?"PeS1 󘞲n`u6dt㚮JR؛1Ru*4 jl8`j BzŸC\* AI [ Oq Ltzo@ph`7!C]QY6 6PHFN3^j3x 0x<8>('?^DYOc7ς]%€hS~;ӊ;I{rN?:p IՈuFf[}}vy>xf+7b:<.j>8O^B;:|C#RkKƍ˃̸?xrlU IblCY ! TNvϹ4ׄ;1}XFkej ~EBLVsc+ɯv5첲x<2Z+"Q!Cy<~Jo1sےS(BErwⱩD 6-)/8.͍V@>f[2"& ΞTZHMe\-+;V~aIk7I yL"a&MuPI7)^p| ZD.Nle'h~iEL1y1uOȳ@3}.Lmr.ӝpEzZtwռ,a++Nkѹqպ];ͼA ̙wLo-k5B ƖFY6ύk,@j6W7NuuPev||S9o _2hݾonyxgRYVsALWKGx6 NcZ]QZ̫/jqNJ]Na%kʸ7$뵱T5Tn0O+{EjwK._9lakwGt[Ƅ.lD>l PUzuͭ%t8Dx17Z%ݖ@DLZbƘy|qT*̌-֓8XEVU 8۷"Z9/'sh+ZsV ,}`0XNɰĜf7>Pv/႖4u $uGZIF eRnjFbA#Eѱ=u`faPjVZ^ _/+Uo 1݃Ĭ)L`1\C_uCoр>C_ l,%^ŏ;vGQ搵1}vO ^^͝tUlgO% m=Jh9>2=dE*i[ÊR/1uO]Gܫ*$ p⽉ѿ"y2L !\: )w/Ϫ[Dp?Z:OFGDꠜ$^m8ճ,絤ImxEq^Ev[~5p',XxJqX=NA;''k; ᶁgp pcii3,O˼}rkT+~4gViԆ3FCQe,L-5c61=Rb -ؑ<gbW> p/Ν c4=zNQ.Fɧ\OBYp‚:cxoH˿0VRV~n>^Rjrݻ,k9W5c 8 ڡX>Y?vK0 xqMOيGg '-Jͫ#w 5X&}((u ʇE{ڣ\\+RNпt= Tl!r`f|hNPek*z%UIɚ4g\QrS.w O lg/IOlhdVú>PybF5siB{׻{9sYɧ^mHOY~;H({{v%C5o ï9FW{km3X[,1Ϳjlv<`6Raj+xWMW[U'!'c84?$Fh*ڰy/uM+uƬ=ScG~!Ll TE>NBuB)WUTr\=l.ax؟S4wWa{Ex.#n8p1RUGh`{Uu\'B~(;65˦|~Bsb"G$N.N:$%wFk6Jo-ߙC($)zo9+L*c9~Og?y욢bO_?M5~>dtzv$>b?[[)gfӠBµ;.!׮"#A2P&>RrU2UYJuguuN~Z"s8Oѫ]Pi]L+w-Y`_"XրhR=ޘ7I۸i?[Dt*u۵6CQ!~" רf䏝OJ_OKۋyi)jĽכ"|R^Qt%ƞcTu!O(w><ްݤ<G 2_D/r,UnM܅՟:Q0DyNlLoѻH$Ԫv`gIϪ{C{0ף%*˨?A\< iqm5JyZnA=mڭ+K(1qH}})ѾYjEx;}$Tp%)!C)q7GG6y| K׶>V&?`,U]z =UwZNn;,& huW[udmIuP#~diL=-H5v^wu[F2o-]]x#sPseS荖LӘv3/tyI\85dSKO_}@&w+Pތ|[F/w5&qQ%7zstU.Qeve|̄?QҶ\'%ض+~^Ԉ2KIR+ΌsBޝE&E]jw*WNS^1+ 8-~k'X5lzg-KXg܃L^ ;'Љh"U]MEU/kb^*=&prsm8lh 2.1/a#YvW8{Ϲֳ靝xgvzxm 1Aı$R$CP0AHcB` BI@(#{gڮ[s9}ﻆgA Ae6\e}b̚9ae!4d2kd3g`=Zٰŀ)Z^J, =M^Jx"&ւ^wt+L۳ ɷ sQa@V.qvt){'qäLvJ6bRV{=i9$urDҽ$YQ 11Ii `"Ԇ%N'c1rd7l0|WRyңYFL&!sqw }[g3G6Hߟe=Xvf-kvgR0@j :7}/jI0윲qa0g[!]#A228V5:|KKVwʊؔǞDY'}yRޟGT+gq9@Ѧ7NLo-d ~_^N[!zVx-ÕI $lt6fKݲeeEy#VcqA,gAe)5uϋuؒHx,ekqedWbԜTkvm7 m=c͵4QMBWE#ʎm֩^Qig~~N "r.cCCMOP\٦7V+m++ yuu_DW[5XO2 \'"g,AJ[wO}p8ʤD^%7@ꈐ>okK:NAPۂ+yؿi}IQ9],9tvv~+wSHDyǼq=li[υcVYCjsF%44Apa7k_^ {|7HPZ2iֵS;_dsX4zNQU9.'52S0vnKi>j<1n|Yܚ;_v)pXD2EE4i˫<:}q!+WHCLYXx/jR ؊wY3崣7%VfmxT2-_݉%ՠ)$5EMQ^g46HЈtd&2pcɖ!n_NihP1&QLY&Ǚ h+QU3Fx&ո ,J:DE>V/}gh2|6Y=̦p]R_=_\6ū}>gSKCO1㒖#UPC٘gL,ھxi+/N3?og:ܯw[EP#?V87؅ՔlIu|otlܢӪmex~ϓ(aHP?h\. Pߗ0Cnz@4{޾< BBW}mwӔ(Q[5a{n¯k2$\F"v.">i5깔c!|*1+M|Zg/\8$$3wR_k_zNiuդo-(nc1lk) ʜZ܂J2!@@DY]qh+P-uX%NxWJGL|1%mi1mE*s\߃N9[flv8NF^hJЕܝ*9aVԐt>8Q+36r9zG'O^ B,Qv?n'Ln) n3v .˚q Sag y;Hp-E#k諾P{آrDS1mRkMj7R\)Ҿ\D:<^b \?AS5]F7:t)]ݜ;CD޶QB9ccC"oVYZ {s9YKDitSV ĥJ]DDzSzYb)T~PzeқECk*=3w훱:39IV nGq^Yi$TwS}\3.aU;,ZgPI&>ui>yDzzǍ7ag%bufř6s=Ok|1z&1tyVfkNjA%K֡4maė]7nBP$|=q8]NhQ!t>"ja[-AV-eY턞BwOIt d\/ė"zd*^7D7a:N,BimZN?"ɨG% IVV#}k$WêB47'vlC:}'Z:o,6ssbWvΈldNc-!(ս ~~i^rv@#1\\^^Az':`ա.Ҙ{uʺ4-miA3n͟ ca 귣`œJ|]}?u-۸Ʉ D3E.p1ݜztNDc؏8loV$/nkub~گwl=.EVE)3 nN\^$>/iK JY`$Y\j5z1y&s&m 9Gu1~TO%/8|<y 1$t2IL";JWQ_@z-2'DSyHs vF&۵@uj^tg'<(uͿjmNDt2fyM 3x-EԜz.ooms5, ~g>bD՗pٮ#492] o,_=WńA#8 S1WoW(ޙ=Vc,6i!9v"P: f\}\I6ǐd2{,$84$ҋFNѝG iBkL1C$d6O(L>)L4Kuwgh_sgx 륜$L.6堮FQ";^/møq,(eڲ95^ݺQdb*f6FӐh? &wH@sUExsY<ՙLeN4g{K6jK Yni3q9˵tqǾ[U: ߓZ '~kh>jyZUp83^cc"exN-ҏ0uRSE^L/^z4HznvW%ݙ>q"bmJm' MMe@MѕqQYɳ!_/I^6<Ӟ%DTs}+7Syr@Q7!(Y@H%Xq,ZڌVb:Km:&Hh.I}j24rk CY-Oq{R2S砷6Z]JVFs^^O9uV;[,e6"0y3!Vv&\E4>UT0qX3"z_$/#ͼpzjb[iVC'0)"jFN5-~P[.SsV+^_ʾˢ<|6^'ѭ9i.6fæ6 D8(3EvRCd%m`\*(S |v06 X߳`{,m沪۹SVk\e9j{ttW򌫕f_daatx ¾0l5)ҴaO7f„kb[xzϿ7ɲ5'r#U,~= ݰw#]akv@ĈUs9^)VL;p,;qdh~X9`UE +ޖ9ne٨¶0vo'W$M$s!b®֏?'2_ͧd{h+y]>\| u=>S{&jg"wJ pϢ7Dt~].8bQx'f%f!(< 8t)AmZ#f3~jӗ WmE5ZD%wHpq?aqiPȏ|[f7mgaH {#)_X(/@1yj/6.z\a?Y3kQCPpt􎭔圞*e#g< 7m\了Ƽ+T&NֱXO H 𝷱(4Z"UH \.ೠBf.I[q>-7L4] Nx/<\ns [ Ž r Mnj{ N\DIC4?VaS^-X/4ި9;_ۭtt{!~c>9dz@mn;qڎ-A?^M{YDZn_ƥuD$31RW b?7#CT[]D0bI9l;)x' NӠsIMmx~@> jk$A@;V$7ʿ_w.]JRD )oK8z06͘.\]#ޑ2Гq=6KEdss?;۰lk1gPbgn{fjlg85Yˮks@1eINO2^(XӞojG@h&azK^: څ6B"\Gbv ^`qe<M]OMD[U֕o0C7̙zzG{=LjaJ-gv׋R)R$<S*UsĴ.j'{Ki<opG$Đ90 𚌖OZobWj79ctĽF8I f9Kʸ B?F饲2uBUJ3#}D,e070E\vC0lđF$f!VK-#A;_rl]ObUtǂX_*4C>.{# .mG M7Q;ccpy\ũ"![nI)׳'3fKpȝ&Fr]\0?<ߞ!,gvGoeĢ7?cv ۡ%iE8F׎u؄MDen'q[q.(b|9 Q @:pvl;>:A_t}w| Z=ќωu~kF `&9ĘhȩJw +VnJ}Cz"{;{ۍ3!8#MKnQo5ccR?H'ڕXƾ4ҫr_rg%UaWY]`Oi㠚, `b)\{|xGVZW!Tm}{4l=xclD)}@|BP *('8^bߐIT$}Bm>@{pq]W排)|q{ ,Do-Q In*iFoRzi~ ?*#ǣ~ 밨f=!Z"Ce[ēclVKmWixJϲұA">#Gj:[jjyu<:dz, (#G+Z{Y+jtO>u0fkLkG5ѭsT?-dG{ j6G1^clQiRK{]ؙZng-[&ǝd鞹wGULN %}ҥׯgMgj"dwprIi+_U Fh>"q`rrR9Sl]_镸G!ԒA\lloߏ` ;RV֑H=ᙻHvS -ziNpczz:+ԙiU*F[pveslP^骦ח?%;'4Zd3/ꪊulءcYox׎q;5z56ӁH۱@&LL-dj㢒5EOu란ʩ ѮhZ7ݞ𠘞5\ȚՒrתt;NHռVL"}`Z+G^޿fXK 2ynGSIhm-Y4nu~jKjGEV>#&ɂ?)nLvvŎQr9]atI_6ρL3HB XPj Ql+NEWV0D;oS?~[ .P , Cp*A\&b0j^kjޒ cF:cBF|tX:^{p[!ph)UsK-Fg31'ߘ>OE|ܼ?ߢ-XuL^sϣ7olM *MXX9t&NA8OZ 38ZɳYt2,(M.PFa R&*`|"ͨƊc}qkiV\ o~" a@;l ڠP!{'\]v9(-gZUdvY9?;UTzdns7 Wڂ8.@޵"A =;ԝ}[vZ7PADyJTt&{A},&mΉ_1.`][g*fonTamVXl7T܅ cNzSB.>F5?:ޫNe;Bi)Ug/|E&_R!x@W.am {F@z\lpۺJ㰁r@sԽ}^`VĎ9?߳Z@ I8T(ͅp_D 2F3ڼ*Ov ԗPp-ВR~h%kfBZI5POMj~O>vdtIb}v%w ̌KOi"AҢtڕȶ}OK{! S.DЍu{FmbdݬRu(k%F\vUU/[''co+F +e(jn'L{57:ޫ5 pS9~!ATZwIyN )ı?WgSp[ =qѡehvxA5J$.=rKmՉTۤўP4HA lYRL"lřP2((HյI8ڨbG:um۶E"d<.oޙ@SW& V4ndG2(vsh>986":k!Hi:E}'BY8`̸27$`姠y@|'ȣHhXk9xb IW&&y>Qn]\wʞG8p&ebI*2Xa+"FJvủug!YOM$Ac#ŋ:9 iX:DP~bsYUV0E8ܜz߈m i`0+d$ڍeh,mM3VV , (Wښ!)W2\eN){)H.60DbSQ1DYb~fHmd5KʌޞsSMc,]*h.jTΜBy"7fw* E%*GYTM"ھz~:wcy,0`G 6U0X94\ &Xx%}K45ݘ$r!ӕٔS,|Fy?Gj)C.FtYV]p"ϳ+ CրLiGd~>S<9XXJ >Oƿ>=8>C%'D*cX=sءdyȮ8a] >LY hZs!(jެӕ)~j,yGKr2ʲ4Xzϼ l[xXñUJA<}FfbkwVnN9GrK5e ;W_f}^=Ǎ:v 1mmS$c%~Awh~Ŏ@T9z|i/B+0gFDl1(F*<|׉C9\taQ?Bs(+a!`J3CA"nQ'T[^L:33#rx˸ɬh(KҖFPHفOiǝ7riI i>4WE}jp^¢YN F4XS߮u0܏ɶ3 foYۙYܝ|qbJ6 }Vnaa]eroK'5ao.O@qŶZToSTVe'⋺Mn.Pnt"Jzx&3_}0 *TÓΫPxޑ9T>[SP$P>yIJ}pt2lqW_(俯{ -h0AY] : \ ޿t(QH2A!$ O50؎9,#!z6`K&,]Pf}<}ARH+U[kKmVn8 24ÃS@Ѫ&~P~fC[.sXOt_| V7 HE issѭǸn /cry\~C[uVz9ב=0:;b.:& =?k$\$;P_Q Bhuζ$n\xтݐ[` cThcPV̷Z~R~"*$Q/_Zz6sp` Tg۾:Gj*Uqi饽X7e+F{͎ȴDT*[{Cdp,557=OAݭʵoz'4"2fWl՘2r/ EV)`62[v84}PF*(q,Zq\lWLkZ#ZY06ufs:gq##_OC8ϑJ( az)rys#?jz#p8ܡVAܧG sᆏ뜱N8 !K?38eel&-72ND szo_qu']t1_P 0~ɑfG:.Ծ ݖ.ouk`uk%Z_+:*"$VrPKX*@Y+'6E2"t$/Ve >"9t,J4,?Q;?*uRYEWmn ֏f{Nרه=PG* 6xiMqyT}d>2 x`rlZtRwrWiISU /٨s㵗 脌+/v?Nc.!ޒLver^!ޝVqo??3=~%H!w`>vY=ˉ%}E}|Z^cDբ /^^|8^*L,^ѺBWLıw>^~?L2 2b4>+ƫ')+MJKY"dW]qh$K[u^Ovk=Ul|5R%J,f&YɝizXL,)R)Mp_^14{@6tgWVV8+vId/Ep*Ա6&1/PQ;wvPp+dNtYW^9Nj,] Db"uhʆd 52rҢ\$۽Ov?%^$>N3jX NX1K1C?,/XZg?47q{ٸo^EEQ}#8R(T7'+-^6 %xTpEFoݍٶs߿0 *Z6;~۽>?~Ƞ^ͶkTVORt&Q[^US:[䭛Yt:h3u#H_.F0+V5R{"ѡJHEN8Rt?a/:ΚsD9|C(jWh\O;.aq1ZE 3.q΅ *{G|REL;̀RtˬՠyDBSU/63jٮG*W(x:Ǝ3YjBYfR(vmj*?]s6̾hˡ3TmؼGܱ-Nmy'3M;uĉΟhפΝ{k-՚kUW*sMm~YP"A͊S'&4 5ux7R/@Ao U˺%Tɚ3Yv'S5VW=ǻ|T hU?φh zPַ*J\7G:楢^lhduݤ&?c}ll~ّ3[h|jrP/7r 1גu5'/E5JLS*CXF^ =_45;S.q[lFQwղL]~''c*QS/sWObcAs̷A0O)|T'i´h+!YȂٗ$ N`? oS}PHtzeᠥRoT S/TJ5z!PQ؂ %suqBtחU7{QFFbYa$(9LSQVtZ;%K@Il紂Y2h3C#[2Eı]sL5AJ ?YukN`VxZ7Dži8tNg``MgĽ^c/x.wP.D oj8.KO%cEU+Nmb6j90zfeqL[s*jOYІ:K4p^fk_s3]i})Wu }"/}Ip8IrZI=v{,,BINQcDtDumQNz[yHɼ;k譭%S_Ȑ-c<ƩHr@L: "@w<0LU™oQ܊75U |$YimP]zO/-RoL]e/\ |.݇\/@OsZK\%7d{w]<;o2l /m.~%R\(U85;<($+|̬_+<3<?Y2cZQw?ԗWgfݟ^71Ħ}Կ]̱G8s ,e*?&W8u۷p5LIL%$6So:.ObzPNfmsΥ'FÆXQU:|^wZ3)Xyme!9ܳ;P7|N]"@K^"W|e]72q|Ԏ/te8tݷ*PPA.H˄:&ik &x V&@G7/R c0J8$ &đG_5{tl1)Ldu7"өό[U`lCDɍ]>͂42 9Q u:Dl\P=K%lj7o;'|$F CR= F00i|$,wTKD물Z]d܉ʍJ:Ul֡q}?KfΪ~VL-u4s/;Bl#,ϸ'X+,ץ4 p Ă?$:jzY2 6\ BiSWWHJ({=6:ܻk_q]n,.>@&)A&`T5c{t@;noﰼ#e?\.h(|9ʀ'ZQ(9\08X{cajS)33;esj>v%M'[v$z>ܙ{-e|Y'PjW/:r \гϾV*7{7(&S[4ŔI#+K7J |$3Eq#6PM$HmvE_Ԯ6M0cl]F/VFk}#B* "mdhZ(zG_!VQ2ҭהsSr^)^ȝO*WRHxVNp11{ڮ09kK :[wfV5UchѼe8WckkrL78_|ĻT -(R}^#F|>8 &֦61N4Q}ؿ}E:2'_ӌ!C^CՕLD_87>z0IIZ#9euƉF2%c5PU7t΅иZT.my!~7:(seNK\QPϼwd=:͹}"R0RSpH̒x:-2OW\(H#4#?琧 cREHAK:j;{{N?wbĄP\Y16i:7csZuOqMwyU[$ǿ΀Qp<ïq$qL]WH2$ߨ^.]']NJL{Ex:t9O{'_צ 4~uⱫ6̚>R'.d$oSQLv5M DgoWDY+&^2e(*nh*!e*XMH 0s /HȤ'o}~|xtc͉q:n`ޗ6㰱E#T/--M8"hLlQ7ut*v+VKG_sajM8_̤W]j6RMf/-~N[[c | U_\rxU= ;鄂Û=Y%|wpAّ,@]LS8ijkܭG9kϷwÏ"ފx0㪴`o4kc# (:nGX,-"iokGXV"~;B4epGaz$j5&bҟFlƵlwY9:cwn'O2(܁i[Ex0]\>ى 6a..BlGLQT&%YFQ:?a˷+t`E*NʧK~D╮`ﳥaB0wL !47 xA> Y/ k`#[a?Ҳ*wvU7\\coW1{LOaeֈl6(<E9Ģo0 B3nQCqށ65 !x,(2#˺53yȧ~u5!}#Fxd8?>`%KIY/hn6Wm!CWeKHvZ&JF%Ggmnյ[GlggTR#nui4S#7./Zӹ_fdH$' eB[iFEΑK 0gSXWm Roח[/+GY|s>Ӻڴ9bř[N}E#9.ݭ7NKm` <'~Mj 1{!΃-\yjmme6L'P'W|E_2j؟/Jؿ`x5M|0N>Dz5&^ܪR|ύF2.s®Ҥ更vrA< {\,P}[fB^@WATC\Ef%쉒lid'ZӻuAGTI<=HؕT5ܤV'ռD kΥZWky  &B90*ѷy,IVxۃ_rߤ]u*…ayp捝QV2'%ӫ|PMkߚBUqMʝ7}j Ϡ Ж}pyzdl@&Lݟ!YKmd>*P>avjZurwW-=i/{Lٱ:`ON߂=q5fIj(ڤoMO;*PyTY3ă4mKĞea[V+7ő {Eգcj~1MLzՉdgsYؽ{Vtq-.Q}BzaɃ-\X6gsXsm|b!y!7{ x韞5oP7k#Xq"Lڍ{][Cf,יF ^§I|{9K}Ơ) ["ehIr7(,:nn1!}[ڷvEnra(0dv{dQvGC}$?2HvU'>d>0r(^T\ (EE5biuJ fݽF}pգ*[:$l^gܞNR`,O@2&!%憯.mF3^sFUӭ˩v ']e>wJw<5""$}*aMR uX<+tG.x<{q|-Ur|-/<;0煯m5,"yOZ=aU$4 }8 F4~na&ÕP+XLy9K4o1@u⼊ ;$wT|VFBF du 'KEXӝV?|8/EX.~&h_Ƨd|Fٵ*i,Cʬ,"żl&}rrTSqr2hbrv N70`&2۱vMhe"ZkWMۑGǮ6EշTS)Z;;_7O5p_![AN$aI9mSFCP`OvW+#,,ſ27Xi٣YUt0Ux Bh;ܵ c(DkNa$*Vn En_f~VJͿIBX|Z`DkUR:7*Al^kn?ixD@5P5\=1Ug\4W{ܫs?uiut2N⬏]yB.aֱ6.u.֭Կqg%vU_ UT{q-QԐY/9Zi2v$E=A֭,-RW$J7h2_#õEHU3&ȸc}TU-N<}6ch1JOy\;2S {NA4Gs枛{iSmZ:V]qc tgJ`(Bj^s 1}?H5aX֓M*MD]E86JhaWcnѯ8"q?{9쿊pbcWVVxHn<&y|l*J_LxvSA@ "v / qƻ>tg_gq#u%'IdEJZmaoQ;2f6ΪӬ+3`jt[Y[Dd[?T#~{o#+\nik>#WSTܷKpI?lw- G]fl-c7N]r` >:J;wSwh$[8d5( 2*Zհh=H~Kk/ME0\QIHYЕӜ}<>}[bp`P ߤ/T.P\=Y]s-zi)w#?~$Zu-z),w})ZՆM?3,د&y("*wWI/ճ1i?k̗ p29{s /{S2] ~$_yũ<βFhy} U%ݻ +HsWQH n[tJbҪ:;ݣ~*WY ˹& tǙczKb.,0``FN1HB!؉I֛,\Nͱ9Gx7/ެ8 /{}&XWOKF3QL}ofzj8\nZyvZ*VbW0P8B=\p5G"ӳ'oP`9ߕ 5fouNr̈́U!j}j:,.ֆbCoVnsΌ, y#BH oDmPiHj7mVhM۞s)쫂0$KZ)Ɏɗ3vWU9RSmw;;RSXM^kZxcؐi 7As廥Mwb{@Q$uڵv|1_`O3w5Nq;F"͝a?vEe_XA w=tk䥐%yD)(‚N[)6oY:ą?{{n18}ua_BCWu]>3ҁϠs=>fo=Qxמ+V8obe:\^ɹ};j$eظq -ZsbAA-mvjCxo>R^CSމ9/ɉ75nP[ rł-(DovH>B!(pk]-d WAkȪЖ 2<ӾBpof3$V7R+`zw`UޥKiK˝CQ6Fp/lQGkEGmUdjx}pʳHI9%bqb'z<Z(Nѳ% Ev q/p5|}TD$Vm%]vcIvN.n\!{VUk7ҵDv~y2Ex4*9]6=wEk) ^͸8jW.]!ظ.ܫx/7j#'!ю."H8XR;x2%Cڣ`X,(+2ۚ] ID]A~8o;"RrоDpp(glk2Nv4An(\zGP_\ y,Vy?,ͲdͥrQ6eot܃@}wlm] Mn*-oɷm kav;}G*vƳ?~ؖnAi=~#`zJўw5m? +u1G7\ جȧAPr7y –;G{>n.Xɛq5:Y@Z# z Р`@[[DH~CvħYjj|)Ķ,)yEuE)}L %{BzuI-f/kQMk"]Ye6_/Zh_.ZGL.ivstU\-x6ƦKX}ae-P^#Yrh<}-Oq?ϼVM[8?%/ĵ)`mm S;f8~aўҳ'LrҨs<==384_f|F.~;R=?9|!t-OZ*[Wwhzh7sUwާskL?Lu |!,ŌSz7_Leh}~n/XFv̇fD/]*ԭEfX,3Yc3 5p2}W\| SRwaw~Eѹ57o/⢖x>7Z-AͰaclܖ]%(Z&1 'L+sx}%ZqmnLGgy9.ݒ‹&(?sil>\:ⵤ)V} |%ߗ3x T^S"هQ4ް3q4hE{=y'{Pa!hފvO$h%hrzo:[4+vh~E=g_F\Il_{,ULU-g[hyTZ|o=doo_Q|v\9b>kU/&w`-qQE"gEQ5G"bnݍYz̥y?%w[d&Lvɯ&sdsV>;EK7g2slED'I}(c_6 vf{rE-=Ռ(1wy4Hܞ>i3g3nIE3_ynM EQkz EQEQEѢ|xd^_6ya'((((((((((((fJutPg |ݔ8_#NBmn;qkn,'`*jr\0n+z7oo3tI zIn1[>Nһdu 6XB7%6۸=\m lk^.t d.[4tdszu,edm;lCc#Ã053831`1p}cN1GHl!#d&cd #dFvn~r¦°1{էlNvHn{VqNt;G36 >=/>}#=0!e @qr¿1r%H,$7C߃ia#pk6Ar>ð Xv?C Bw 2>l0~G٫Oӯ?iT۶!k\Ʀ:̓--lO1cqG5Ֆ1)m{;6q{aiZi31$ǵf)?wycۯνO71BmeHSK^mI|[ƵjazP|[)mG-ݑpp^Έߪxվcڞ|ؘatPG|֑6fڑpBlL63[Ķp@Qi;'<ݓXl:g1c0El:1әyۉbÐiLRvr$J$K'ɟOANt{gbq򹮹λlX G$c)kq?|. A J°jwq|f@?)rsc?9lu 0,m4X/I?zw ty.WJ=_!d1%כ2#,rXêobz)gJTVi$|E#ӕ&JL-{y)U g{U s_]ϔeylnW2X,SޯLWq(7 υl[6鄕UGҡVDfJJ=|'3Sq+vL3=˥1Ir!al`=I{ n2LRXGAJJeccyYb>E=G&nyCo=<>Ƭ{Nf/YCAWX)=DJ>AbziFzH<-#43S̸X\Z.`2۸Ar!3r90DMr)vU`๳YR';J"szVk)YBRe|Gĺ`  He?D%^Ck!> Ht&Zu@|1[b^#R`ړ O8,/2oT:r-)+9hJ&2t|n/iک)Z{E/*Ear/  AJRlVԺYVR^ O,2)tIf6Eus/Xn E$8E  RTjYփAAAj R)t'VZHu*AA 6ye8iy]ͣ HIM4wl]); 2C>OL2,gzJh;*'|> HrHG-#  ˀA2UUNC[w>?TUߧ_AzAGPߨQգc1^MշC[շ5AJ&a5)hH_2}~~~~>KEMCKAG>OO@_?OK\jn)­ڸnwF9Wo_ endstream endobj 44 0 obj [0 [1000] 4 [500]] endobj 47 0 obj [500 0 0 500 0 500 0 0 0 0 0 0 500 500 500 500 500 500 500 500 500 500 500 500 500 500 500 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 500 0 0 500 0 500 500 0 0 0 500 500 500 500 0 0 0 500 0 0 500] endobj 48 0 obj << /Filter /FlateDecode /Length 7885 /Length1 184216 >> stream x}TՙϹV[﷪)*hEQP#Њ++M $f`5j@21df|"@G$ddB4LÙM6}έAd6?u=[_13&}sMW3o2گ[Xt۸s냧{Nά_r5ѳ!1>73~qcO/WofM+w lyKsWnZoNQƴe@\3,9F5xvz)MNS16w~}o/2;W~7cCIldlMlw!gs]ԉ; +7{v36MO5&sew&~nZp+U-R+{J=M-LY˗{i% y׋2fhkyv-__ۊ,'ZOKv-u\'Wޙt݅}"1L)MM2?ʔUcF GxMu~Go*]s-޿t}&Jqy,Gz'!_ ~% ^6Da;(b=]Vl`lv59:7έs٦s~vQ]k`_˴k޸tC:!;f SbM4XFyxWmr:4.v z^u9=ld9e3tT7Go{eʼnc)vݳ3מQ`TJ>{=*n0*CK>mY 9ʩVdz{JӬfcQ95afm;mϗOtSl}X5u溨a~d0-P9挜a=#=Ӌ=WasiVcUg'Kv2 +T(Uy3+le31%!A;,~FuΒBlQyVJdZJB,Rp{]SԽ>UQ SĜQ֛9s Ng4s_uN^wguy[m)wYlʑL~RS6-23JnZLҘ!}=M֓@ϥk_{#FIed+]o77uc{ds]ߚq=}QwntF]s[|wosE[_fN%E^wu(7 eF=l*pm-lcKdd#+/޳#Q;*K=EE]3f'Z~ܪ3㧺'70U]WÖmَ߲gjF5+ []e'p9vcq7>DP,LFm_Bg!OB->D2L@± y۸o85؊#]Mjl9ݷRE3Γ7iȍݳbFrӤ+Ch?p\;Irq)_㳙\945ڸ!J=;K-zo&ۅ I4%BA4z;krR!hZu>a;~sqdqȽҽǍL>SL̿/T:ov4[d2&$bdEϖl2Sg ^:H9NijmւhzUe)=ψ/ˡj,'1(sR5`Iϣԛ='rtS.9 șv.R݋}o3U5lZj,ISUZ=Xjy3۝ۥ;>>|UӡC}?t&dMS–\JټΦ -cϧ4OM)ϱa˓1:%NʱWgO($ 2g1q$j*6r\qDZBJCD&&V}V̴$MHȹ' 4CQU [..PK4>UjD/?[<EߚT:;rҝ}fr%3r[StR6.z`20t ILkalYE'ᔡhbp$؎(PԵ3#Rɪ.k, ca(JvbGA;Pxf".cݓ-?+FB5fC7/žt:4҄z:U[qMkb)Op͸=~{jH=!jq+?u\&R_4FƓ˿(Ϣ3lKvHޛ}<+eaf sʕ-^+9BcZ[ϸ%5 y|au:ENȶnKE/2Xs1[3+rI#?h_΋QKO0Z_(wwZ'?ѢB - e*Imca &%ۓ=TYK_JimSi `mbX_L*GG*?LĴ靭!\y٘MK_ɺ`HTkFb2L4H䢙UQ3hʶ}YdEh%mlW6E_3gF!YvJANNbCc4duXSP /M*t3rɂ`P!IV^/ʽ'[>xIKjߪƖ]]-=piҖ륛}7F,:nd9|mPڨi}Gȇ-8#h2Zߜ6w9'2\aA^ q'rQ7& Ĺ*p;7旝Wt~ۡfZ=llj@IXUJBdTƦ hUDEvQyhD`EOCE&q ZwńҮ4EJ"gdU R6G(wS=^JLY4/O'}o Iujb~6Mzf@ќoSlc:ËiGrh< ܉85ǖG(& l)ٓC d>ZcU1q2n(BWM+z7[%&!m*NvFNRS=RYm T\Zԫg DL]\Ӥj(yl|bMd-<kxAn#i:}dSm z5~m[OPx`{Dڝ\' YsZ7Ao+T]Q^5ůIjC^pTVgk?*,GL$IʖEdW8kTQkT+KimZc͐[ϴ;3J32Rg ß^:ݓzNf;ՑrB!ED-mm.zebPvsՊoޙ}{>D %+/K/U1Xԏ?9j!['smP!ӛY3_'gSSYn=*K~wj0]"k>.娼r!ERE/C^sw-pDoxY5.XużL|\mCC̈v(oJ͙ ϯ6LoRZX~gqZo>L5̳Ϣ${}~}D]Ds<\ M=ڗ:::UJO9~WB@\";MEɥI=WYgs53VꘪAu65TkYPce뢿e.<^JN鳗9+./쿶~e7"l&~u^iɸKz>tަŨo:{uSk p9@'; ˅0B{o]{kv]Xm/hB#}sW̕KUv ՂU @^PԌƍʖ*Gh2ZE$ ݽ9Jt'K>tThN˵KSNcAQ^}յi|ȲV$w'KA"{d~ss=Gy$j}q̈Q25$'|pTV{X-n;K]nKەNG-k klB]FվIqDN%|1ohR3կ݁RĎ3h%F%i\D+rާ}v(O'ܺcv(d7>uj"LtZA;MuA"X'[_oU66mS:/OQ9bfAr`1sPJu_@ѩ9J1x{}d>1&!և՘LͽkNS)P4mZ߫/m3t׋UeϗLmd֒%M{~2չeS fYJ)01f,L>YHj9vn={Xu=F^ݻ| W .FQQ߈GT'DS(DóƹLf&(K2{ ?~)|Vz?>M;--e;ߠiT$yz` ͬanPiM(Ĉ7/=VDڊ6 3frR$U m;cX6HKԠ/`Ip8rf;Fiرpf\Calmoww4ܼpKRи(yUӍɵ$Yo5667gԯ0u>7`Cy63<3wE01Ʋ>eYw§YoMط+oݽ\7.K-Jl=kn.wFSA΋7,zWu)w%[Mg7yNdQr:FfzrF;i޽C&(w yy+XIgW~kꕫj4m]5w=CMuWZqx)wcpҵ^VSWy^WP=׮mZtןcj[i/Z/D=}uort{kYQ˪U\ow.G&պ ytj]WS^={}^_NZjzx9k<qFP9O^,aJq&fj$jΫ=a'bXo޴;/<񌝵~:Q*Lc-~G)11')gd!hlhE6b۟?.|mp6\IT6+7o`[岱1<߾fpzڄ &ϱE;;;<5Py;-YyG^dS=O?Sg?W~p_-_?_~x ]uR^_Pw?V|o˟(_k*"(br.XT9Q-"6.?ƿď?'I2_Kꤼ*KRA.]#.mG?!^^-}G:)HzE?H+'\/*L] endstream endobj 50 0 obj [226] endobj 51 0 obj << /Filter /FlateDecode /Length 77024 /Length1 165996 >> stream x @U}~&M~IGD¸` 0 8A7j,ivf8Yee7k+-+.[mW-k&yA ۯ}߷s;<HLUsmHUVRZbc]O̟}}sĢ9e>gT-~N׿3^"󎃘qEՅwC_p6|oyZ\8w\J?)` uCX1Z׭ -t4}{E?̛5[ #|)8d W;=Bko3'o}s mwV3.nJ q=o~:`x V`UciVDOuC<]8YXAJ8N} ,%N|EsOZ:ObcIjղ0RvMOv˺iL}s`Rwņ膶ysw|/;R`zZF]0=m0kW7}Ip93!|L!_ ./8Do0-`Z!ۄoT{pU+ /Dx-b?ysgi?3 O$골D}i}O>j@u}7OP7&cG!²$4 p& e:B-;PHR фӴȴ$dl!h3`^ Y@AH:<]BBFrɯцTtU,-^\kw ¥u;qvM 1_y3TҪk֭i%u.Vx9ʀ&u˽~ח u[|~0G}4, ~nf/of|Kӏ_sb9v @ߕ3(p?<2M0@=\{ | !_WY H }wgc|\DUɖP\ж+zhƈaQH8CY]-};n7x/a|.X6f.7p\ Wojzx#l>V߂r5e=mp'܍vwa{Z~l6leVmJvB]xfTz`/<@|^a}o`c|;H3~OS>k/}7 `Quh˷(pb@ĐЇg?@ AV*A-hA0 f!JGCz=?1O[aB8K ?GV>+oL 0BfF|NUZ}"shͩ3-4űsgj750;olܔBG^=sb_#-b3cGZFcɲFL7x8a|%+Jm'N!+Np Ie'F2UU ىt:)#ݜ=N\`V4Z5bu4jDڨ$2mc_BUz|є#5FQݘ0r*fuTjb.60q⺔D!1;eD6}b9tLc7^g?kmFsQQba#69d2`0rd1!a :+":jY)1f Z53qvfbK¾{,8R\\X%(8`(X1AƘV=hI*.(+(#NZ4b{q☻%EIHR Y挼;SG%Gb fccT8^&F[$:2: G },=?G-DИ:!ЁBc3 ,7Nh1Z?Gk'j㱶@=w?H>׷x ֦ zxbr$ħ쉘$=oHKseלrs]+VTB=6q9 qySƎ(g*!8oɢ kxŠӦ ;Fc1_Z1vs䳪&岿0=6zHzƁ3'G %ڐa(4Hfɀ(,06-^Nt<71n <¢ =DP6pp$wF|H3tq njaO3R2щˌɓG$Z%J#)N;rzhZtv*-iSh5A {`2$>`Tg.)3> (/Kv`HE%SƄf9sb^$l'M4 wCd7ka&gEGgM=כuR#QF5Ss/Ƶ^J-~' Y)x})@ R}xKJjVYcK(So඄|!"k",TR"D$"HD"D$"HD"D$"wח3W7 )0F̂65\Q"/R*HYYbeS=Vс1,m觕G̭[7`lF7 ;mZ;Ʌqq6u>^c;Ōfە}xlZ'G^u+Os=q+'?0hN~:4#;k}wCk\x^] ?%#lmmnĕ8S?ا %׊ޖ*E_$ۏhⷓiuuqr6-hG{'OѢryЦǺwZʟYX^o*j7zX,+y$5Ξ`~u|tsgF|pSms86h=KCT礃ȟSKufۈ'1lwM=ٴ]s+|9yΞf(vR64tUOI7||ݍ9?{3t]DBoO[;8;Ŕ.%]QolgfʟtB3QWÞn`g;⢱-׵'vy.jʳZ[%-}^yu6Yg;Z[<-rWvm&]:ڽ2W:ZZ-fo:eҾ+lÑMrx\=Nq:Z-m\AÍe6kqvӃ^;n ͖[[]r3.\nis;}rKcrZVq4-VY(h_'7qn_3=܋mͦA۲}.Z%\,̍.~jxNڴC'X'MPǰAyM6g5 [s\QwF7:yrSq|>{jaaGG-<Ί慾un*ݼѷ*ҁӯfvu.?g:qr\xNO[le^I5L:[E7p(Ʈn Xܞ4hD+g*vζ6褫)W٥<-tsgg&k_@n ΂=vś\.IqZ)^.Ƙ>߇a_d6V'Q\;ßJ O h?C4hC!E7r:JטL5?l]?>:ScbjEO6 K6"fƪ'. ) l,h ZL!Cl-hkEhh1 =86mvZaBT-@)h~cb`h{Z,:v_t۞ᱮPz?Ԡ$%uԩ@˒Nt*^{%IЩnݪ :Pz&1QF}ԋ\pjkpQЛ{1}7Q?b]gkUVq ~G*`вL!}&/PŨz}[U Z͡(oFhѽ{'<ʣ׾pIO'?tS :tH2IwKwiL#zG~tClkOozz'Lf`6Hm'p4Zk^E|-V f{HEqWyaj׎?@^R"CQBk JM-۩E[QUU0rɢ2,ab?1aU`8HVjj00ay|_?t3LTԾu͖u})np=}z+ 8>u@Dt.T~py" 6`tt#TT7+5 v.2 3S8tid>K|ؼѼI|2J҉/E}:Vh^6N)Ϣ43@WSgQ#% e< &.W Q7rE ۸;Īb˯b/헣$qO!(3D_IxKߩ$.wixV WqybⱰ$'K"N)U\*,]Jq9/4ɣ$d{O%=']E:)lc|.i-~YV(>9(㳳'[c@ΞQr(w!JS^ jaW' &yA@,܋ԺrEc}Rƽ5‰(œLNj|"N~fj:JԵӞ>^.Hq"[NW8kf|rxZ۶Yl(Tv6Y#f7w<5gQ\&W.|q~ʯTr,,hZ͂oXM^Tf~欄ҼȳJåj!vΪ:Suh\咘%[Юxϒ:[~QZꙗyVP0jokלƷ55ygkh<ўO3o7ܻ}AEkW\{])5]:{vgYL=Ud RтP\PYpr~&I-H١ ;YZdBbi-Ғ0I`d޿LRA_ׇyYXwl<Ɨg1Yg̚5kެg=6kŅ  }Ec/:S/z{>o#4g93\9'=75wf.gIz생o*tK%`} ??[{v".P;4Әu䕇?ݸ8Bq];P9b~O-<[*Ӈ;];kzŮ\wez!X:=.O,}e:ևC[_*C@txz!o _`pC>z`VGuG7Nzq>(ucC]O<젇n흅q}>|M8; dw֘kՖ5֡g2r->XX Rύ)\))e]<;6`1󊟊_Q_S s*[Wmk57h\>RZ#S[cq}`př;Q?X[ȂTQ)?XpjԸGF޶֮|(2_n{9શǞŕhWaU\ъk㫸nu*'U\׶U>Tm'j/;Au^֯_UAw?_{\د kr/t֮,t g& §/\tDUa3xkڧS<[\|wDwS}CVD}jO\T܏m۷^L);)e=K>C;}{()n{Ok~ɅVaU|X<3*~: hWMvdZ7*Ν#<%ar)Daq?Y?Ee% KGES乡#lWpeOGq#*^|aG/|I}{DǕhBɩN%ߋvr<)yfhJVT::V˺+Uw}'5X<@q>Վ~m;%/ n/!ܛ|3|+p+NٶGvv,4ҫQ]hSN<:.@_¢B\٘Kq<\qUZ<-Ѹ%Xr,o;ShOJMN$O™Yɹ"$=yiSaQ=+qb%Z*u!{'*uaQٰe{y/ڵs ˾p6k@2ڔѦlhSht`cލ,;SI+E#.%Q ƽф7ȡT1Qt`e*Sny]U<_QeYl])~,ۦ˶duwQ|)y\@'o4ygOU2슎,Y2шmUqb4yO2sCc/c/oJ4|QrQ2dL̲H6O2(FXc7Ƅƙl98ӍsxɌXKnOz4^Иͬh7&C^Hv.9PnW:i ɵ*3[=a u~MtGtiFp.Wj\kr-+XX3VUD+VcmhzcCXVEa}cx{jzKْ%ŮINCtEȖhEkױasi;b#у^Ї~0-jvdX^~h\U#Ͱ;ޏtOaQI![^=~\G>_brW{Opq nmƿ_8nr񣎟yTΣr%l)<*Q9q=򮰪m#,6n9!v/ο3*N8_h~@5Va>=ӵ>͖嫓ˢݢgWdfZfefZfefZfefZfefZfݽNmiefYmieQVeL^eL-}m'dMZ֤eMZ֤eMZ֤eMZ֤eMZ֤eMZ֤9dy.\kiTSifofoffhy橘bi*.V쒨2kϬ'G&LZmv 黾U>}ާ/"jLY'Sɔu2eLY'Sɔu2eLY'Sirr]fשujvݤf7Mjvd=Sk5FͮQm&Ӎ4N7lh)83:uh:v)kgڙv)kgڙv)kgڙRkF-S{:5Nͭƥq)[k[6^:NZVouֿ:Fίk`)NM Y/Fm6_>u|Xx Ǫ2j+xkݵZ5-=uh\ى]ã2wlwYe2gAq\?rKF{4H/inqCy_tl\}%,]FEg3fnW~%;wY;vfIO.h;qgFcN$O,f6&3`flM0 f6d8D'EgLy2ɔ'SLy2ɔ'SLy2I<̓ q(×e|_op4c^r'q7C~CXx#xqO7x2S9-y,Ÿ1K^B ^bb?KLN'WK?ExKK,RaðQ1qaC#Ѡ![v/{!,o XxyH~|P^v.5ݱ>=}k/O3~l["6T$Qa(C9*P*T: +Fa4`,a<>a_a_+vǞ4ɾa?|wvP$w] Ƙ9{?V<9)l, bHHWrTV".(IȖ$J1 e(G*QjbQ2#0 1c1eNacb7=qO`^'&Sg0 a|8A8/Pٗe|_op4c0%to7L4Ÿ?ƥp90P܈p3n?3]9=}h/q?xVÒx#xqO7^ތ<^"Ђn][Eu+t鳭tցqd]{UWx:^Wx:^Wx:^#acx xO< dzf<DuK,6"/6l,NoewDUe<ͺqM,et̹̜͜tGCWc02~9O|̷񱨪|']]'0{3My|rTWW$Qa(C9*P*T: UUhXx|;<+̳<+̳bWݱ>}GGO9ǓBN]X8G9> xnZ8Nw;30~VWV}yVw=\_a2 ]%QUeM*#HTwWZ*87رBuR}ſXhXхLEUjt$#E_+GH(2vaQt\J\quq~qn-v܁N܅^)dj>2QL~' ?N|Ua}^EŝVW}qJX_5g,pE-[,Xlbb-[,Xlbb-[,Xlbb-[,Xlqa}8 G8SplX/UZ()-bg/ ĩ> -4h)B/B/{["LU#.%,* 9%9"-Q"<['Dh8}r,C ?.r/r/r/7*wn%.*Wx^>qkCvU;c ;cp*N. p&p6p.~p>̯G0js+fCX:7m?=qClܰ"q1.1/Xlz&~qn/^D) @%Pb8F`$>Fa4`,a<>r40Gs40G\AaE/|0| _WUNi8q9qG~ ЈYᥨT欧bri^x[MB̅xLjt[qM8Qإ0Vn+L M1cԏS?~L1cԏS?~L1cԏS?~L#HM)84 L|g8 gnLݘ1ucԍS7* lbNvjshLfqRZghIR91ǓsC2(e|Ẋ|I1oTAlPK+GyGyGyG<^˓WN.fbY.fbY.fbY.fbY.fbY.fbY.fbY.fbK9.帔RK9.帔RK9.帔RK9.帔RKY.eRKY.eRK\R':ɥN.urK\R':ɥN.urK\R':ɥN.uFRKb5΋긐B?9@wS?uO~Sy橛ny橛ny橛ny橛ny橛ny橛nyS:N?uOhoa@gЅߴW%ŵ1{Ƿv*n@Ũ7T܀Pqh=@Zzh=@Zzh=@Zz :mn3W*P ^ߠ7&' Ə6~mhG?Ə6~mhG?Ə6~mhG?F,R0K,RPC5tС:TCjPC5tС:TCj!á 2p(á 2p(á 2p(á 2p(á 2p(á 25Ǯt}mf^Y(4 ŘcVY1fŘcVY1fŘ.h ĘcADLVmzj{{yrzk핮hdMuS+9*}jݧ6 sS{w8=QOv#{dw|7)MnwSݔ|7)MnwSݔ|7)MnwSݔ|}=GȾ#zd_g8Ǚ>q3}Lg8Ǚ>q3}Lg8Ǚ>q3}+ZyRnE9:iڦÿk&W_D5};Ysf;`]tk'];IΪڐi隦ki隦ki隦ki隦ki隦ki隦ki9#zTS=rGNȩwҽt{';INwѽ]t{ݻE.wѽ]t{ݻE.wѽ]t{ݻUԸ;4k42Lny}ZbS:^s6''wmNh|ߢέ&n<žþExQęŎڋd4:Q.&=.|[HFޑ>z5![sZh􇚳S5AͅgΚ9Kֹ0~͸ͱ쩹M!_c᝚k)bYܟ|^8~mިǻT`gKWN-ٱ1zm*ZSGUT]EnjfdYJf.sTQ1G * z `;(Pp=Rp-R)k)C娗\rQ,GrTRYJe)TRYJe)TRZOQ*GѮaF0$BP3.+.NteDd2N;5b¾ɝɏ+d P9{&yH/yX8u/RkUULT|JW|ۛXڍ5bF˩ap{jT>;ӫ*Ӽ6׎FH!c֨vN/<'=6{rvzjވ>&z<-eR,zGŲwoE]KVtɊ.%#bˆX6Ȇ#eBL 2c]Va.m[{K;U\1~;|y6N&*{f~'Z  <Vg&dWQuEvDžVFS}|w_2x̷=.%6QbV%mH4VF|RHdeCRႤ55iMMZSK{<^h?߿7j.CPsT`F5:Sb>%櫻 7Q{7\M݌|wx.c( ּ,RkXף=\Zje(Ǯ>=W{nn#v? Ll]g_V[TE5ovGYghTI9ĞwFqb͈5b9l#J|22?Ki}ͪhtb^Cj__:b]"vloz .-Nd{7z|o/r.Г^ձ;t;Лo-LlTu (R6qYxTF.V\Uߖ 7'wD*&[u5pO툝n=-s{ LSeގ-<]e pm)ϹH~A884%'{ U䡎 i_fJNvJaYo53Š8'JKUpYr,9__s?ƕ Whtus6oƹ{;\s/CSxXSa*LUUSlM2p \`_խ7ቚ'[=3r{< [5/e`)XWݿʽƵ_Z ܩV&;]]99X#k25 5Fd!kzЋwװ= 8\Ϋw6V֖z\QsQ9X[Zkk1qvp~F#ΧB Q;xc3Q숏wgwc7tXڹa ?ht-ky]kp- jo :TjN5UX[M8?3ƼM>piq'q.b'{/**CP>j}SUR/T UuJO\bP1U5d*xV9qm>7,N֯7X/%F?[[U{롡5ioZ^CfHʘ f͛͛fN^ky={vh{@/xH/x,7م륚=-4[`/Y| 7W_}ޯ>ﷂTwGe׆uu{\w&QT?UR!iİ UQ"dY;.8T\`DPٔP f"*34lTB }o̝Sgy9t5,x:R+ jjjt$A-V^§Ljȟo,׉l1]d')QNokJ3Fe.; H20v@d$Iv@{owʜĹo2l^S.9d$9jN6»8'1o#FUVCZ|}YwX=$C bunu(q[!I5GS]jlSЇ}XGчutlrOolҗx?˔5gR+4F#OK*~UA*G]C5vwnM{iv6v~1Ā ׏R}/uXiCe72BZ}Vߠ7_ `_>pL4z=m0Mhy[E(YsZfTbX)Yс2ׁ*ZkZƳZS[YtQA$^2*_*Oʓ̨6ړccUXBB:cX:ƪO2.bV1X~-c̸=feb^KF7%ӻz]Ke==%X+`\Kp -c[uKn -a5ئ{TˆӉgB>ﮝkZfPHo$7R^jXC!7;2քw {wil$65(&`#q(Pd)Sh5F›][-,<$?/_qW_#~- qj 2Z+d1Tkh]yNcI}Ɉqw ;ɴܮîصwJ6:ZΝ:Zæuشm6m2{y_'Y1Cg|% ׄkOӧT+:@^|~a-uX~~dpIXZ~j@s5\h4Vy}ՀjOs94N{|(|>|%vCwݔ _5~{_kp ذVcjlb=u76܃a56Ɔ{lXnlJwcjlXE7VʱZ9J`M=,UEX$5X#5X#5X#%X+$B+$BBbx <g¿_OzF2F2q` \ ڸX" n;AGa*LO)sDGj6Hŵp*?!c8΀g08 Άs\#< ?~ ?/"ÿ/.a4jD6') 6 OW|c,y6`F VE,tnz@OثGj)S|s0*^$99O٢5`ȁ3<VZMjV^ YM+hCoQl]m w;&_mMv:t Ȅ(mbMLs'pwp|߄fO'Fхw&C0L`,lda# Y؈Tdqw8v,^[^[^[^[^c{="@D lHҡd@bT>k<5g/c/c/c/c/.rD T чq<.V<#z[IDM׫msd&KDTnY2_ewr*/ɪ+5"j$ LGa*LXsXsYsYs5w<|Hǿ_fFDoSkC6 V3S93|L^OP|G>#,,3YK`-}]?|rNc9\<+xbη?+47|^ cs 99:qU??v9]Y_}=z:0.gzy 7a8}o`.̃x< x^|X /+}e^a>tx 'I3ŵa6́gYx< yxA,%433Mt ]@-nc b-|Io!YośEf Mt ]PCtn @$P <_6/%D $QI@%D $QI@%D $QId.^2/+"w=0p_p?<GGFMGMGMGMGM7u:xSoMCܭ"VwU*nq[Eܭ"VwxlO>'_}O>'xxx"jj=:GgL3}tљ>:GgF5Z8 mp DDD\"Kd^@yGyd YB,!AT>BL!A$%FS>GѣdHJt"JQ$(d 2?J䏒Y$,扔= 9ן_K@BD3|(3E6YG0 %Hy$<d 2G吋rE9rM5惐 #GUPY%$\滰pc2\$')8\K.#  @\"5B81'/ |*TzG,@,nP֍pA~[x͞&}[:EPE;> A8>9o͡3}TC>O> rPA>JhJ!-|r '-|C-|==T{%\#=r}\#=r}\#=r}\#=r}\#P].Eu.墺\TrQ].Eu.墺\TrQ].˵sәpf꾍vswr pJ\Bsǹfߠ웪^뷠YyiBDi-xK**w k:5e7ιZxQzOw0KDQ|Q_EEQ|Q_EEQ|Q_EEQ|Q_EEQ|Q_EEQ|Q_EEQ|Q_EEQ|E*檋XU1oRrZnGRZwh}Dž-]J'2yYJjD]D>oQbK~])]@kE\1+f%2ˈճo;E_}I-z3ht#w8l#K\%JG%R?adfTU+aU"&X`C8d@&D;p0C3ŵa6́gY6j`@L4p 23'.p@ڒ&T<84U1:w\`;w~w0u,O?>O?>O?>O?>O?>O?>O?>O?>O?>OӊUG_}ѿ>G_}ѫZFЙ@hZtћiY*\\L)N1U2B7'=JƔ1q,"OnǢ$JW\/ Rq!}T9ؽ6Ω>1pIx;>C5^v-}S~}|6]HĹxPRkWGWUp59do[9diNZ8/|&2>MLrvѲh 8-C U {AB=n~rT@o>:]bXC#_}L)vSCF̻ MຍJ@aP{L4p :Ad589VIbIMTbcLax0txL琳琳琣琣琓{oӗ14]!P})EU-n{85qZ`YV"NҶvK'5 [ʠZp# r̥\>>"U0_ctOJdOJh>(Joz_d f=^+@Grrrrrrrڼ^G-̜UAmkZ6,_W㬜/P;ESVP[QQc5ROfݷH?2)~$GB>q6=dpe:}i Cŏ>qpD Gb5fK7n[8^2y$2yqG_ب_87꽰j{.,k$5cP%Dsp=$XaPj!--У!fc+; ]`",tIrEWP:~a&Á]ëp}2Gln 9[NVzdviUM/sÙf::F>yP͎g'Z%DO1w/ K0j%c&xMb^*r}l37O|?7S"pL0tjnդ̎B|b+º.c]^$bVг}-q*ɜP 9s3^Ce\ tErXsp0A\d >gwQf"k&UU"C^QgGۧdNط`M9!<ƠfTVlvJ'fO~j:B_* S jk1҈a"P}z. j l)b?idzaw9jT03X'o', e :g;?vFC8F/8kNxZ5)l Tэ:Nӓ9l`dN^~XWou_^ KA= K[mK,Я8z/JZMd> pesnF&$k0ˆѓ{ QKpu#|֏گp=Nz'r}B 8ןp>hQPW>݃>0'IM>;2}P& ePf .hh"cGȤж}C} f%^C}0+}?&ص;xun#2ѵUҿ>Tu?N8V[0za&VOpD躡èٖv|Tو P#-vڄg:H؃2, d` Gj3jJUѫ~X*ћr}(w2e)˦\?dդEɱ.m U}*7"'oQLInigpV}*N-oԧao~qieB Sɹ/gKUbVF'ϊ_-qȿb) UԢ?N6D..hjQn͢QU' DѪMҖK-_jmZ~ևõOk#K ˴c_ik77k۵;;x}v>YVX]֟yo% Z^}7BQo>ԏm&]IK]JmdUFem̒Y})_e?_KȁrV.$htyV)m&֒r}%GʟhyV/*5ȟ˟ker˫u!9Vަ4|Hȩr.z''r\GZV,?rEr~5@">Ԉ#i,zcNOco|nl_3JJ〡'#"HH=Gݑz"/OTE}j2R9WE#zm9ҪED#m6ݏ|mFF236YJUf;2je%O11Glsyfh>)G3ͧl9ΜgΓw ̅.sHm.6{e2y|\idG9,2?3bX>mn1Kl3n~!LO`3r4/yLl K-:Ymbk5R~a]`] ˬY__Zrk5FVZW[Wֵ֯d5ֺYnzk5^5Ś.aXOY5Zbt^^2YKFwUeXƉ&k1n5ìC8k7 T60{q}=og4/ik_j_j־mo_e_cfǑ"bbD6WGyoy_{zx{sl5ݴon2uhn5LY.Wg~] 4uU3|cѝ<3_w6 b}ɬ՗fnP{Hu003,a ca~"V^a/=<τ‡sc`=.|*|J 3(=1_ODBOKLe-m+R>XQ(>=sUo"³">o l㯋v9.CSv^2DzKq En1{g7 ȞH죽v %v-n9sԼԮjݮګUrVم8],XMy5d75v]n)B9:~ ;YVv5ZlWTMGy-9UD#pl;>㿥˿ݎsmk?__K/lH%^gGQvfvo[oڹ;Ym|v]xEv^9Hj^l2S- ڴ􌃫[-C{VyLQ4C_btבXv-½_"LDZ{QI98qP5GPM}'TH!ykq'Wt!־ idkuQܣ/HUYWWۍEuVyr$'gk9)۽y~a3.{GO&Aowo${Sz{3):t=Io[c5z|ꩾWnD->}j7Lj Wvza0=o8N]$zҽ]ܮ44292iiW+IIz}og{}O4'A ?bhO'mgC^c؋rB{QN&{QNIE9؋r:n9As:&H8%,kP*q. ΕAsMP9\89]s <rng_Ĺ}G@n0'LufYj:1wf1w1wcY9 s|gs|g5s|g-s|g wg+wD4WnT"G6Ÿ+Ƒq0no(rQ11<Fz2L$#PYYG1X!g?e'q^_ǙOC?qN@?@o??A_\_ھQRhk*p&Wk;Z\G7a߄oAOm6Լߎw;(w-G(q1p1p1p1p1p1p1p1pH1PфF2@Lr)Ŀϧ0]|=e2Be~6?SBJ2 GcVT֬4^cw;l֚`6 lHI2)(r "P\>7 44.\+ѷHsJ EJ  ŝ ':H܄΃3 ec c(hV)%K?՟p#nJcn2Nn'*vv;S9A|AEEȿؽKKL!.#ط| ޕ⫢v @S3e`Y2?? 9d+%(uܾĿܿ|Ah Ѻݑs ,;;zB:e}{fD\A?R tm?\8_0.O)\Dz?,\A4s| t|.3@H3e \ \\\\(VJ-G-/n;bXBݿ^ʵsV(Ol-y{]GX'fPk񯿾]./'vKq7;+_kӎm{>~OþҳCَCd a}N+0>.|_Eiw!MҎk#Rgt9$Ѱ Jq~ݽ߈smj%_ y8rߺuh$;Ӿ8t5VƶC{~¾rhLH֏#Hq=ӎ#ƧFPwPU&إK? mww˅?cm6涳i ۷1ƋvZ~I{"g<}Z~e.om;hfL۷0]aD0^uߩ1s#se^O£6?)F?|ucG#VI/7}*udFīw3bΎ8~~ԕ?PVpfe2~'@7g{֑ۀ],k_ᩈgnSc֐/#١|X=MJy+MvuUZ9+Wq|{}r "鏮8]vLV1>g#ҟ].7FHg?__H:aL׏cGwȶxh.Է!^K1UX~?|Žv'raQv=g:d}.:/O$UǙt>u1rdžkϕ?71-u]s{Z\nO+FoCSiI{C$}^lgʈȓ;۳wyTzΣ|wlo8H|IRװdmx>^~^ЎB<6GW[2yIrHܑQ|^a~Z_Xq+( Lj%IWLcfiN5GKa-Ȱ>^ZO{B*<}N?Knj}O"ཬ8=ވЗ*1IỼʶW z7Ҏȳ7*P5J`/cď;yػO$CNi1RO4<z4;[c۟KoPPtpY]sI!;R7ث2aQ6Ykڬ9US׸!ms3ݒuȊ..Vq8wMP)Z@%E(vv݋܋Z=NqEDr:Vs 8>sp QEt)J\»t;edSJQ/ai't+o92ȩԠNMk;ܬt籢Ȗ\ /Z_00.tN?T>JΓ '[O l] KH~@9:R3#3j|=FWy >J7![Ro&e/Qy5V|5NL rEA䊂Gg ~\Npr>p _:B50`t9JhCUH]U u5 u.t'' |39Bw՗KJ}-Rw-Vjo}AN}'z{ߥֽQC5ܧC}u__ߏ6STkcP҃ДzC)W?10=z8H=(ge=cG85F'D _կd=e)ȟ=owp]5O`g\Yzz2GAsyzoEm^ ezYW7M٬7 l[Пz0! 5KYg9_ί@6Ss_k_ǯ~}:o7@l7Mc16 lD~+ZwHf-TY b`-Z kA ւrP`-TY `-ԜY 0k=X `-8 ւ1k`-WJ: nAY0;tf?F3'G Z*Za=Aj--CeeeΏ"jVt%bg&;'vEyHD%3!RcsB 6`N#xj$߄eDb'ĝMg7 (s2E"*o.6S%tJ\ _iU*\kE:s=U61ͦln27ͦ;'ۑf.sn*kz{m^s/,3}b?rGP3Zd!~<f< E=Of~39ŒgͳT͌4#s>7jƼ`^Bz qfN4bGͫU}ͼSTiyü0E`5Q ̇T|d>c 9l y5a|?PBf15 -1KL*هʆQŰoُjCp@8ʇ#p 6D&JRIf"%aT('#L0Q%48\3,C7>pS)ON-p)sT\y&D>|Nm1MSDˆE(Yt}p֢jq0›}a̾0P/\3x20?.%4~\Zqۈp{a~n/ Xi m/O㵹e Ŗ̵.텭uMuSX2gm/l5M}᣾pㅃAO-pAskzaj"\z|e_#j'̲~̲0 u[- 78|j>͗gc};7h`!j[x͏G~BCꙥ\K4jZҬBU0kZY UZTATʋZ91+"2ր.R%d01QG*/jD#lҬTEjZ0f UYarX;h's28 JDA((UJ!>8:JUDG(U QUxD)C@UG454?O"=8J j>>41U=TKSZ9e߃qD]:!tA:n/;7ݩD0a8sE:tw>Da6|R}#,tG+"lFAU!d] THWKN#F8.m2KB@v/ܫ>Hpn*%AtT c^A0ὔbO]ϼa WKCF A T{ ==/HW|o~ a=VDDb~IiwAmdw-d0a !! !%888 @IVPjBȄ%,G(P,y Gq,R"^Gq.ºQ!q'3\wW~z~ۤ==>3xK >ݟRRR R?*g g&t$uRN^?+vRPȔz])&"b\K>2<>K9lTqʓ#72U1#$幅˽'a<ˍ7a/i~#coAE-jgyw,ў5R퓒=Kx7 1G<.5\c=;- V6[!?LyԖ4|%g&X ɖ`+̔a4L1GM9*os̷zfEyfsTh'ԝK,&q"J-)+,nXa(ѦI!M'95[3LTYJmgJX:5avӖ3"=gvN4l3IӁ3ʟpy$9Ͽ-Y=`y|wO;^RuӦYJQWROjӝb%Ylb<:·\ߗ+ ΍3TE wyޕA}_tW\bණ뺨p#m{^2uyUsK zV|װ)ifK8eKVҴV 6UY\|%u~2,ה >˫m-^+=:֬7,@a2^VʐVk~˼2ճiȲH5:pr8nNYv=},/5n嚖ghӌe8oy\W,OQv)Mwx䕴nWj51ʔ'B~O|.g{C>J^(3͈/jʌVcaoWs<_k{e9Px݄vLYxs:_w,^ =ށ\^#촲\ S<~`%{uwY{ǠYeYϏ(_KB3?F8hi˽?nv JvPY4 Yv[,.aQ?΅]`zK=eyĪ:5Jծ}5l$ЁMHyԝ >]UZ;Ta(+k7e[pXNuy֫s(8O.Xʜ (W70(l傱,נRku]Uj 5cKL2&zwT|Xn]R`Eʭ7}9ώzˣ.Y=]uw[$cүTb}=n/C'}ٺA!3*tׅ9!ٳ|źBnN-!wQ,jpDԭ %KB)~ B)u[BpG >@#t'ѧ/-|ݡF'S(Jiz|qlISnkdaw%M]o|BK92_j)}7ZJEȗ +BXV w<-6^\o @ @QxYkqg@{`-7XnK\m鷥n !͵\e趶eԖ <-S"߭yr<0[me[6u[5DvZBcc|vu-6eצ{߷m=ƟjOny{i8m#ԞCzCT^ubR ª=[gMh`⨵^nE:}mijϵJ lDxԷ}!lӞyf=/z+}mX_g[jmc޶%<~!ٶm*y۽kzv}J*ݶ#h}\%ڧb2cgy(Oj_ԏ+11: 1}]?-5ϵ YBXܾ_/}x~b!v;%mwӁj\&ڟ2?ݐ_nNbblU}ا(j۶Ɗױo(+gI(IoSŹho525L9?ߝ?X:|q)֋?F|Oyj$s[jA/?O)kF8e'+WD;@6հ_OH?O(6݄V\k-AKd*lOg.^ ZICt&!Qk=c|e" +%(§O6Ku[a:GI{mZo;svʡ%Uw[n5^mKoݲE{tcޣ< }~!{ݺgRv[(}T7悩J-Ssk9asu,l޵4];=8w@+n9u,6w̽mP@[\<ܖhiKVJcmiD[fy-l[~ɼV90/فyT)5oU+süVwjWm'q6 x *mb0`>jsO|>Z Qm=tl[zhz9m\SgۮofytR(0mfO^M'͚M:m>ݗȑym+)\zp.42M.nۆ죶]%жʜJ>]v:} ̒7S=`;&xr;^ɡ2͸S<}kN*Ӵ΂wm] >=. 8'x@_uW_uc:4_cgbz1Uk]3Ǹn ӓnWnI>0KW= +9UW 97KK[nInJfWB%y z춻7L<>żyVL{Pr 1%dy.{f0a+A=0j0ڽ1ƽrнqeso*Lb澯D>+A}} ֱ}bT Amo6DG8w`_Jd;NjHvÎ(CIG!߾;$5J)#P*wǰĄTH*>#P k:`g;tRVG$v\0pRAGAE̎NvԜ̭.Nw\2&CTa0KaH $-pHwȆQܡ єS7 &-3H]yaQnX;n֥IlE;nHcsmiB t-þ42<KKˆCic-0;nk7[[Mic'H{'ݎ#uJR}JS^Ve>^Q}O=jDYėQ3_BIg3V|g~Rb!ĦƾRc/^B[obc>=Bw5_Cjj, zPjB_E:t [ԃ?_T4oT "=AL* HJQT2eT2j?Q?ÈRZP(ZQ(:R~RU5U_7_=oDu ի꿧$_7?ޡZ55oB{6ug^㙟94g4mשC59o5R_*P|AsA֔jPi4_\Rj5:UFUƭ抦GYMfXkFU;UfB󏪯k4k*f]5ۚmSQ4WT^o4Hs FUoFG~䫑&2#3GU >A_EU~g8DND\ī99ӈNDF?EnFGnEEUD|1*#j*:7/|4eFA` J_!Sd f&f`<2 l0l6=&}&fl{-xFʗF*瘻o sy1OY)_R?$:[DQ~Tq(}T?PQ~&U"T?V!ojT?S Eo^P\uEwAc[/~%~Pkկ+NJ >%F$D$?HHDIEdFdR""P*%GitǠ1T<9L$#4&aB)e**XÁ1A3C5fgfYdVu!;dxh鹴B,Bs*j>Yuño%vg^v>M#;N4 m@Y =gBS]p +I" I2 ʆR**!}]@_$~N@uzOedtY^A$WҟvHI`DB߅a FG }M@JC?ϐя!} [I~&( H!}Rz~m7:iJEE|*l_!yš"w1B}}zz}|xEEwJoSZ%jB_!tWߠ̔UR,ŢR6JD6ʇvP-X+/P[T/ՋMOK:Yj5S OZVeXa<(0 .3_Ƙ"10わ1͓,SS R-% 9F+o ^X5/ DքM ‹$/[2{-!Zp}I{C"‘ ΛT[mQ̘- oj[,3ނmg8[3 T:ٖ>/t-YxKL[kJwB,!y ]b+_RjHWjXɛtc5l |oru\Gl ?اE^b[g䇴 uA[sc|ۮ>'C[nУwȸ&=e{glޏ0K-ӋwǬ&fCq+Km[;MH߱a.z۶w*S<}$$bo{D6aUb??=~/a!6V\䉨~gQ6IgͦSd!μ[{01!b2(CRgö9[|b+66='*Ox6[26ѺKj|ݺ+?up\f/l^M!/A|ɽ`;¾Vǰ=n{ gOǶ3;hbs}f "v~e/؛2l;9{%efu]޶-ݱ]"> p9#11p?+9ݏh{g%'kyFub9)a_ۅ}#`\}9geǸo |x_H~9\0M1\'XUw`a᪄XN}$'Y_ ɰpb!z\ZH8}%g/q}EowcOܐ[)OF%7.EqSR,qpb-fq`N(%awSr2pnr+!.6ݑ2m)ە}@*6 w(]H!^6]tbvicNLm~6F",ﰓJl6{%cm>ċN~CgOgg3 cB3/wX!ޙA;Dg6) )<B,_u^N(p[(9/bcT8ʜJgB 9Nwʧ1yNbRIx`v**+ۅcl0p s{H3'99FX/p{ݤ Ǎa9 ⶅcgS\XׅcwwH36ñ׳q׳1n+>eI.mTcI.]1Ox\eIM\@@b,E`9/ɖ2ITJ"RN{V-Zi^Ǘ,]ҋ$MZwo0?9Kt+-[x KO#1i {ҞeZ: YQx Zǖ%زP?WG4iϦ#,]G=a1#rߑF#r SG>)yrR#3|C9L8.98\?!.>#Hу79x8F89^vLc8q w;ös?X:ñM~qr}7%:9?g~ON?GrXZ.Fqrs8h5A&4ݚ)k9?sklyO~+%HbaēA'%4}u)ДLĭo.cDzKށ_!#׊1no$c|ۆqmˈkLjh?QFϑQ(v~GRiw?xʜƱW|z|VlDlLlsc#׿c_R$ؒ4fel>??/:߸cZoVpo^ݱ-箙m93__J͍U^{ספUU'v,v,'z}NUU#c5q'W{8ި%ޙ[75Wtoo9Hvi#6W:ޡvzׁ{ROsxo|~.kX:)t*>+$|F$}WIY|7DDA\߉([H'XHܣ1ߛMo&I,E 8>1>Q#%klPWg[+/F$Iľ؄DeHlfciߒ3I+ &-cK/%%KMOޚ,N%GH˥ce3dyrBrrlBrZrYK\<%&''%ʒ6#si}rp#k7&$w$w%+˓͕<&%O$5)Gf^RyFĸԔj[j1AsGw_j`jHlK*ۑVtFƙHH%SԔx$5=6!5+57>.2h1ԓUezOmNmvʵ;>$l Q1:VB;NʓSM=͒KҭXEkHIߔ$W4=<=:IG]rݓ*1W#qieuүe֦Jw-<|~\qњ:]6)ucv-|^\xn"ChWtzA֗\kCQ֒ءDŽNU ICn1ZҵJ%$eCR&y tCɗnH֓<[!5o?!jy?DcC$v}cѹ'kcH~H)h3v>$y<$.qP PusZg=GP5vS__ gEϯuֻ^!<^b.t܋Y)"w\]ۢ&f>i$I-*E<ҢB/ϕ#ELr`Uo^/*rMʏ6Hi=Rw俢Ѧ%C+J{^/S s4N>qϓus:9nNꕝ=+49:2ڌq$j"5g%v"R:oȾ#=/=Ŧ',dVՆtF mzk^|=g]'>oAiV]p|nSW{6*Ӌxej6?i|@ߎxuhFvGс:T_WG͚Dj=Z+OjVlnAǛWEExB*=Nr/(^˞x:Ų(s]D!<}Ckrs9.e?nd#L52,kdXƏ~+)߾B2_/jrP::Bߵ+?GY]Ր5{QHԻiB/ txv =u¯g"V$W`$?":>1-r]oH1TDhrdZdfdN@:($ZYYr"UcHMSWҨiI˒6%"J:(]үd`ɐHɰQ%J%YZdJY%sK-ydiɓ%JBϗl. ,-9WrxuRwj.m"*mVJYi\ru-UڧdMJJC&4/._\ŅB_\hd/.4ŅeB`5˃݃}cqߍtN߀ཾ| 77w O2?*|Hfz<::<= QCd *] JF^uǻѠu̿ J}jnnn%WAkWOp(\5<<:w fKBo63qYx%҆ذ;--~oa12`wEݾ}mӃ?n nu|wuXu?:7w{RtO.> ](ٳVNE7_=w \Z,Mؙ1o >FnO~e? s-xJOt1#_ u yE0Th-#: ?E) ~]X`9M<-i P /!jV;7*qw HXTw$ xԓN;=e"*xzzI:|\1ʹg $RT3h>8AJ]F(u:kx>$3F򂖢Z@, iC e!@t!_F_3<-\G ўu*"*{ҪJAwFOcm1cm1$6ڦ|JӻR;A>59X~8X!6>טQ̣p2c}#RiUW}UG"j4xFёl`M)b{EN G]m-i=ІH#iO )oD{RcZQ:Z LDg4xz{jlğ ԙ%iQX5H¯33*yP{'>_欢^U!sevQwH9YN7E{.2w-RvO3;dȢ0 rT8X~sвNJxG@Hyy" 'Gx9%f෻=2C w.`sl|6g,퟇=MnY.`+mپ9WkC߆G&Gn&S,odFWyVQZ>I$3,UMjO{,Ar~D,N=$w_ck^2# ˌF3[ż[JIsrvE9/2_Fd1s?y!san+~"xXC)4/Sv}Q: #;(k9bڗNW@z}/= ~${,e4OzY$SrHO9mX!G'eouR'/3<} ɜ]܇?*b4ޞ9/.r?YwӃ]JO-o,dNj/?ӱw s$?2F5v*_r :{5=:/RSWjLJ^kG;'i0ܜL4+jЯ_*$h'a?_JZԏ*/KkoµLOqˡmWPsvka8gX荵=#nMveh&y@wѿ9Tt_eG*wmG`!4{=HfWN|VTo&IJѿ>gv+BKiKgT-K?h)>Z 6aD̽V> Ӟ*:/tU>0]ǵp2G}^}<+⥱xi,#5/) }-~(^HTO ] ~$^ܚ#ML]yz^cL f=3}i&Б4BC2ǚ{u}qu'k=;5;w(o? .UӏΕHp ~CF<-P̹yS,W?TwYAzuڰ.BEF-Ew9:ݕwZ0YC$Oi3@,*puݨ9~\xuʮ`炭oXN㟫/ëS<;8v6S '9_!]wSq^ouu&XOee \3h6+T H3hRgTA%/ّn|Vs]Ē|V3͵;~Վ`TO9ݦCsvνE_}'Aݿ Ϡ#y,p3c=́8܅+iWsA 4x ix ަ{e`|?~rg҇8\uh-r3zj5:wwW;{~sAw;hvʹ[΁?Rǎ%}mϳO-=Z z;װ tN ԫCZW;-uA$ExsRM'yXhR%]OK=JkN]bc{t-X=Ky)kPv,߫mpk-ʉùϼϩP4+IP=1MҾt]?a'SLSۗzNwxh/f@R''l&ގU iI05jXTөq([P2=KFz?Y. 1\Xt0jSͷ_Vpae*-Ht^Ǿ/x!޸ =;9ǤwPjDVE(e--Qp]gXeV0}<ӨX&:r{~*gjc78])vX3|h^{+Փ?iJ8Sy>\]ez8yr O(ڿUҝ- o}zw߾*D_U^[958qso^`ZQs=@,շNDIa-m1GbXyL-Ĭd} _m +)݄?m/do{ yلZN2YY5y1֙ym<3gYw a!ي*q@qN9c.ows=o8I=\R֓hu,2-<_`!jK>wr%DӿhBp4|X{B01uxI'X= =^l9~ڋϱ4rR^ea{ g,Q;o쬑@ܶ h5m,MϩA0跁P%w9`3ևX:t>\$L'Ux)p1moݿUg*S_ү-W6!7eWï*m$oCGV+}|^>pI7Чh? \^e}_]IH#)m`v$Q0$|B HƂ|T_"__#P%>vcZb kX5W޺ 98sx \WsusOt1י~7_Sj7}%^/TWE~jZdLM(e(#*E eԥx=u݂?/` j1qBsWOJW#isgw`#0G1bQE!U~ދk;/&2kVϫ)^fX3|v2z׷Nev'|83kJxRȻQ:,NPK )QN3T~>j ?IgN-&*Ξ~JSlPیytY[ kn:guNE}_dX.~5^B"-6<\kzb6 >Ur~8| 8$ϚrxYS =}/GǞo8ԷD.Т[ԇAy|k[;N$i+X|WT;!Koxfk!3:P^ \Dɓ,%KwsR_Ol?Ii&}aWP[tDᯁ_CiO@C,Y;,[Ȫ_fZk)Y 4WvpG4mx< 6,0mVy ~ fu#*XG0@J< ʃY[#yI_p4u"nB +ni?Y_y keX(#oT%Ufվ45.xvxloF46# >;!2d@V)f3bWQf5#+B gwՕH|BlC6MkANZۀ٤:y|4؂_jٛ4+|Q){?/ݯ_y_y-9;j-?ΩscG ;@s{m_7]}sI7[d}`jqJRt7+:oa-鋝3(lԫh;-@uQȇ)YʕQw~E7*g;~ F 8\kBEQp+/r"ķÖQlScAV){f{{r-u\y#o(rC]J4c,~G٧hGUжVg[frW4ٚ_MyO-NoXSgZU߿| zXp~_,itSHJ-[:m-wtd-k UpBVT3xT 0Vy+c9eIZ㕷XoG 24[Pv_wb֪{'{/j/mP;늩O.8y<_0G]W|(N y QR/%[>5H |Qo N(W!i6TڀO?1t ?O~z/(􃏃yuH?0$iO#ŸUlS,A}Hӓ`sk x?ca::CC~6Wްw)VNZ`Eyx`Cf3:;1R NT3Rʌ]f~zŜ~XM}xmXwӞ<=K4Sj/f[ZK_U&?AnڶQ8"hR:Hs\"9p5e3XC'yZr/x(^A'yec>?A?zx"$PN|އ{#Ms/PVڻΜS 8IH"" "*a@D@$ d$""""$Ga9$yU__X|{׮TQ%Io}Tȸ^9czA %qWc̵`ĚAuˡ!7քM J_@l}gOFZpŚ Ě<60klb{H6=@F/u5".@ƌn ~Z`aXew c`HQ"*G  *^$.F({DAzAk cNs,•*g__dZ kp "?Gal)"9#+#3XnqcaUYl@)"U\_,Fc< jv< <6:Q8=}^Ȩ+B?0d:~|q]G@?KK K`9`?2昻38 aX 'v>`Ϫ,Z/Bn AXqo}gуOFyh!ǘ@x$,砵!_M}`h;X,2zq@x3AhcRI?!c-f&Џ@xYD @QU%RNm2;Hq`'?0cmvNolb*U ':!VG}K>^xfnjOeva&vn;fL5fh8gbA3=ح/7={ %H'V Cعh4k ψ9n6mѾ6`3"jhf.4A؇-67cqW'%0G<jj Ƭc_Vkz߻ӳ[n8̇8s؏fRg酥ZUuK`-d0zO a3BQk^t09,͌jGw"d[k8l8%GݓpY',KqP(zyce>(*`FW;KpgeOCe\iNbJ@ 6lhƆ!2k1 ӎF16z؟7Lړp":f5D|똆hfKF{a_B/-0Әo ? nM/?gF@;!7U*fu>4opn~g*π(Vw'xZ>?=63VrM2 _O,Dh6 #MbF3sM1_G *VC.Vڴ?Wh_0 -;~<᯵  \LSb/[/;iHxx"4 Ӛ^s'W=źadm#4=aY~/e 3^̫۱: &BE~̄)A̷gCJx Ύ5q_DJ) #y YK}'ęBm̄ ץ=3G1kMfaxB=̷Ϙ9+܌@>SK0Džђ]Xk7w;rxZg4滩k=iÐKB. 9dhR 4kufCN|#2igZ Faйa M;qh4k$9Ӽ!w2r3ּ!M^0Oef iߗ-|zL~ 6=i*4Qc`d4i(yĬtf#VT(7|36`)=r>[|G3~A)т/1ha<@?g$Ƴ̼ .̺4ZnF `` `Y*M;[;vnGGgtȞ\\\ޥmV^aIyU.:9 9t)QyXX XBc)'  3888xg=p p'p?(tͻ8ׁw J U8`V`.``1`$ͤ, | hvn=qQu$l&o;pˌF" \HLG? 9׭3)ῌ2e̅ =hfpNS:Se,)Ͽt̋?c~*/Τ9'LgwI:돤4~:JWX>ϪKbH6cv]k|g|-O[",")v"ƊYzBϊiΛ9|=VrG/$=Ͻ)Wo?3ƥ9/ƾzi'3Js^7yǟ}9XD8:>dgX,>IǪvspNjf]$>8VՃcGQd,Zipy4WT4i79ߒlpil\ۗ-^R%uPR#\n/ٌ-(IA '?\n~ec55«=Y_ǴL3?e(P/ճOӱtԛee9Vr?֐5,AC,cCưOh.ч:N64A=<=OOcx&>x64iTT?*TZV)^UCQYʩGT^RX}L'Ʃq:^OP15IMS)=>SjFOjUQ)/՗Z}M7zFS󨺚S@-jZHϪOT 9Ŀ:vBut\Iuj=Wkuhڨm}YGe_R):ʾ@9[猆jOG 5Q%j+a|(-5aM%kIs׹K"T9TY{߿-o7XNjjVN դzP^h{;!!)4M4]wt'%&)M19-żIZcRLo19ż]]?b5f1q3XbñkPcDZ[p}F]c>19#$Kj3Hcr0#0.1f>0I؀q#F&L 0iȔFL023`/Ff|02'`䫀z]b&`dddn7# .`00`ǀE3?,9`diȲ#Y0:`dMڀu#_%`dddCƀM#F~00-`d{Ȏ]#F7`f_3f 90r,`xȉ`d  O9790r:`Lـs#F.\ 0r%`ZFn 0r'`nH4T0̄L̄EI0r\#lƍݴTmD-QGE;"nM$!=1T?GQqL'IqJgYqNEqI\WUq-R>mL4ϊgڢ6 B$KmEg $D1"Y$;;I%ޥ'b@q22eJa+mZV5+كLHEٛ8˼ǷU{YLVf+fe׶/|`=`ٖcI+dXa˵<+b)+k.KϭíǬYOZOee).f+X!VUbX#֊ubg21ML-V_/4s庿?ZХ ŏbI,?%bX&5FtLa2[֭%tt#ܠ[70?mOzѻPxgw]GiA4Xh(rpAUQ4>1^h M_::|K;OANJiDgZBKuXN ZIh5qd6fUGBh;Kǘ=~:@鐎8G(tN)Y:G]K:]totn-Mw.E)U1z^_/ސ7yޔ_xs[o';7d~~ ~~V9~^/ ʯ7~m~QC-#'^EcD&O@D_[1O,?b,~[V"b)vb+8(YGRmvkeX{}~u:dXGcqu:eXgsyuѺd]XWku7uӺeݶXwjG IYE>%ʧe5.kȚYYK>'k:|^֓/E|Y6Ȇl,ȦUl&Zk+el/;Ȏ|Cv]d*e7]){=۲-wd_'r$!=9T/r@~(?#(9Z~,OX9ND9IN)39U~!g/ZΕo;n_];rCܡ0w;sǻ܉$w;̝Ns3ܙ, Kw;֝~.q/ w]np7wns;C{=q/+U{ͽto;nMcgyxG1w;N{g9w].{W5wûn{w^KPExDDq"2D7E"Id<dddd<y(+;'7/?R 2.2>2!212)29idJȴȌL<}>{I\GP*jM<P4]x D'گ3;t@|(>#bCGُ!oG:uy딘/g VEF؁vvJbs9N2~8?5vݛc})Pk;:,Yw'@[W)t(EIJAdE }JkWW╈j ^ uI//=?cϰ kr_͛93l![6-L|ZZf4 yΑ&;_̊=I>c6D̀fײ?΋ct7+>>̽a;;}m}㘈{Iڗjߟ7X/{2z^A/rzy^/ z^?Ͷ<ߪV_ʺwU:!rWkiޡ.w={>VTfsǬ|yYeQ|_n/dڌlVVX]V{!֔5kMY[֖=aY*zQTe)m3Oy2=>O#p!Oh=>O@D"(B3D1-%EUZ޶[SMtNogYu}þڷ[,bٝ,3qF9cXAg3u&9#lgwVjg3{lgM]9{ʲ[ š¡"liXÞY,Yl o٬fvV;asٹx;" [uK0Op]ӢtiE], KF,2"X#6ֈ]zq{ İ^$K%!wUH=>0먆u ;G@|B>Cz1aMXSs(?؊ k ť`4JQfhB|]}gȘzqm?L`qpp~~Cw" qx@|6@*dE֑9Ğ #!d vdؿA (¶öE`?bp{aGPdPt4xQרS. QeHS`2H`2}[7N(u.GwT$gE$}2}G,Cg>B o{cyv+@gQO}S810`bc`88$q888Da8$qH !YC7fE g~j$FW m+BWc`"K6̅`:k w=ME}sCs>!M(*z!uP_b#'BK,'aXXN# VXXBk,cd8e2:b"*#lyFc+`YH#Hg$+e=W\I,{RX~J3'"$@q@[@ўBTO&CP@: :EuevPrFu"tAT$8Յ;׳eEu-EA"FzґEu/\1@ Z]4&xL<628v \P߉S=EF,!KMf amyl$cqlQŢD(6šD).@~$? o%oo5/+xyxnn:yOyy/|._Oy|>_O%|!߈o̧B ߔo7[-#V|kߖoǷ;P|J(iJ@P{5R5HmsbZ v2,щ㻟)ILϽJY@SɩN-rq!ކr * ]&cAl&a(g P}AUc;8v{=n/q{ݾ8vAQ{<_EgHIɢH=g[B$M{S 4ǁXssX(~dQ y][ =`Oaa s=)lO lOIlO)lOilO ,<lOEd7y0T:b1`?O 짬%}W>61rQ==Y{27/[+"䈁&raّh4v ;R4A`Jҧ )cJHR5Al([ʞr&QaTEQ T*Jҩ9T5ʥQK**ʧRj#UBmʨ-6j;MUS5^:@FLNRQgsy"uB]nR]s%z{.w=D?->o)G#p+zL}41/g3!з_  vh1%0Uf1kZ?+:Vc¬z/O#C¬/H?)(P??+(~PP/X&};%?)?+ Z?(?^/>&dn(~@loo?aބ(((jQx߭-?:;;G"{(&@Ng(&PgO P{-doe^ s+/@-ߢ;̏ !aޗHpP[@7!NH'!QMHd 9Ԗ'w)Q[PGmen1u]ÿO裶aچ!j̻Q{"ru,+[1e+2vd;ۙ!hԎa~TNcC>¼݀G" bP|8zw7Qc}1UH Bl *K:8c 듹9b=A 1@A s9b1@A WH`&1@D f"3Lb&1@D f"3Lb&1@D f"3Lb&1@D f"3Lb&1@D f"3Lb&1@D f"3Lb&1@D f"3Lb&1@D f"3Lb&1@D f"3Lb&1@D f"3o{[r2x/P^Cg+8DIr65Pȣ8l}E(!9Pf%H7=6GiJ^<@d,LDaOͱWckI&ڜ$[iY%,`R;$8ۍ/2-w+_&kG@ h)f+ EEG&' %i)* KJR 0-!"Y.!)1!)89}CVe>g ni7VҴPhӒmY˕i'`jZ[>Q|݇MmlM-h^}~wxp:j_lQh?IdCWd3.SR΁A veޅ-IH뿧WnL9{QX'aUgw-G_PQɩ6cR63ddi6|ײڋi[gv\]lc][hчYGtN]P^Z{?3&YAƆxjM>&˖TsJvSlosxf{'B6ȍZr}sꉪ촹5AoyBhs6C=¦Q*S˔/Wt.rcU|)k(r2W.?W5H>?ѣiaơIFqdg8%k<͸όO9\4,lQEЮm?;Ax?9r2-`w_a8//)MkyѕgCc_tOl(yCKħY>pY]ӳr6cTn45qFexԜ2PW_h]a#ؿ{C m*t )Vs/ޗ}Taϼ&S= m_x~iWIyUt<,{:>-ۿ'sꇁtηr7;-o#UPKyהq Z9~wSOqO1rVFgs G@,G_055 Tڽ^ajё Ba/B )e6~%.j]^.I{\7;n>x#ifVfý'Z[җV+Q}#7*~%]B> ;w9.'x7m\պTzV2'i=K?욜kUU^M]@K)'p'ߒ|hqYx37<;M{-7+[;tn">ՁN74D=2n1ppaHe!L|%脶;jki/c)EeNPF7O/)ml&ChZhjAZ 0bnbfa&FA4"t>]~PqZS5?Ei ?F^ 2A8q~/O)i>sEa8QÑSwԳEcشK]ݟx]-NM';|Z&HBAp0=`Ď4k4F~-R:%l=]Q.׼)Cݕ*5Z%-Ya|Fr-YoVp?[C'{NT.iQƿ۞-d~. {%ʎ= V;%_'EBܳ(:-[[w$~-]jyywb疚_SKc]XLZ#9e7ey~ZmE,XZ59]>&ղnCNŲ/F׫즜H;S}` ?.X|]S؉3V:y3e'Bԟ}$3V>4au C6G.qmS˒ NuU:c\=ʟRmf=g\8&uo`ִn>lrj|mbIg;MW*\ɟ=YeRbg׉3M( 7rQH`0b~iȱ7 ?sV7x"׍NW΀;=6M̆ЖMxslWW͜b4v֍us[ύٕLI=F%ok'ڿ)gw.xG}!Z ^T24#WqM֥ΈTyVd-#/\s9{_hq^{,1+V ^>n/y^0M[Êbg!5X7b[,Mmr.5.*{rIڱ&CJQSo4ث,^=h/ٍGx}ꑭDi쒁oe 9$GkL@gtLjgd >&׌WVZgd.Rג]cӞAFqĮdT_}'32POL;ſÉ=z0kɂEX+n(yj`_.HoZRGtWxas@me@g;çw-'-K)y ^RsO|Y<ԟҭ'ByRj]fFwsjâļ؝c.M?]!#D٦TŐV*qy9kݲmfuǦjJkOZ25N`MM[dKt̍tC[I-5=t) M2h9k<}ƺa Y9RO^0g_uė \:"==7Ƕ,<Q_@:2U/2ܙWU$?Eʪcm%<תDDS[`xBެ~N6F䦜lLgfoZцCi@V&4; uʀQذ0,{9=c&1vL P@cnIJF.oϖt3rz@)?[o,~^EU)XFY^r6(y~t_\,vslX T}`Z=F'lMnas@=ޑ7QJu}͍BrC rn\iۿ}:1t@ FrR98)2>v|ȡ)7; ޖNȿ Kǿ*(,.S,=V!UxۦMר褙fc) _X%_wAW}'Қ߿("D 4"x]RNvtMf:WB_ڧD/SၕtAth0jERL?> IQj"<:ötk2?ys]n2צgإ]/q0ұ7ؓ^Tw"]Tx7E e6z͗k%;㹤}ԇ8}"+Gy̎gcEzV:Jl;v\}Ԅ=jgSCVKq/$qtkhOSGN251g*ɈkQA^J|%;豋eՆ3s_5#jji6wqل,%]s-:[?H+wIBN [('MiSMG\Ϲk%?8+d21a.m]ڞX wtI|KrGmOe]w>%{>o^+ڿ, ܜ24l_^#ySFlMf,~a݌lq n+y7t==Y2_YSjB1eiZ]ځǹi57>8l]Ϗ-9wTKt4:KJqj9ɣ<s~@ϱvN3kR@x#I͉'Iso|w*%f qs2^> stream x]ˎ0<M"R>'Ej'JE ˹>Nݡ>/6ݗ.S c"n}ݵ45\yJv;ۺ<[O%I/}X~c}kWƓ}mo5a>ڇcy|<2ؚ> K;^Bٳ> cu:ܳ,Oι@^d/w{c}$|5*HVTH*H6)QVmD9*'2NPE=Q\UPFg6)KUz);A*$ʨ d`s FG"j ui)i0_l7ߪW6/d*((Ho3x´\6bIxPM # ٠4JJ"CgK2M4 Ҁ}j:ir ].@J3N92lm)]+ݗ%n?n֞~祜m. endstream endobj 58 0 obj << /Filter /FlateDecode /Length 24040 /Length1 103020 >> stream x} \U}}RRtwuWwWWWt:!$@:$@ K@Y%2*h5A;3"2"2 QGQ~{Uws 4B&|(12>ޫS@(m qDBdOCVu&}WCac68){6u<myQ{!擛&O܆\$"JƦ-(i!{QG~7C}e3GB>N}s06d7ek=4?|2e~$<>Q@u۶x7m'mZk9Bۡw|ԯ}B*2參"?̇x#D Bh3o쯙%RFW@#IFaq6u;uHDqM훾>)i+o=>%h%aQOA3r-7^}ƦQρ:B_xxuQ_36ulꨣ:ꨣ:ꨣ7?4Q^ԝ𗤥-~six/m-kl94QG2pi:<>^ś1ߪqeh1NuQGu LxJS[c`P~:lуMC?}:OsAgw.Nlꨁ:~7пz>W??bwu@룎M l 6uy>o[z;=Pͥ:ꨣ:ꨣ:ꨣ:ꨣ:ꨣ:%|R;? D%}I%syȭx{F,>ACMZD'R)o=w]n⁩x|v=w'o{'Oy_}=~O>?zoy^~?i.jy_՞ugѻy+zIdT3nj>9w3<ûl< n}xO,s'>ч\Z2K~t-c}e,_5_sܷuu[u&qM[?s7zGv3>kF-M+f$F?3sɇ/ҍz/9'kz/w=w;v䮞>~zpY3|Ι΢ R0529%lb w>@#S<)`~xDtībG_RIf)>ĹeBxJ*L|Kc߻>.J\ڂ`&RG$zPN": 87B#] ekl-M@z5JHP+rxG*:/w4BpB~ ?#!HBz ?c,gCy{]7ɑITmTAe;th|ҭnvBx Puk Z TM@a a4@: P|A>܁r9PnCނY5jUxeBi0Cg eYxx5hKCƻ)4o77пq%s ?؟s?O5ܫߙWWٟ0p//n?t~>];܋o/r/ߢg}?|:4,uiUi)OSܓs_raЏGǙǸGaAe!A~%~>M߉bv)fE\sgϸoƷ07s7O27q7dn`oױsǟ`>~}-Zj|{5w%}}9%N#B|<|.alb",|&{wsw: {:w{w*z{ocrc-̱&<0n⎢Otn==I#ֺUJPzƝ YN1Bw>es9x.37Dv[.pqLu.Hpp;ʶq-ȴp4& 2.LMqqcLt-!:Ls8mLgL:c N 1*'c9 <Ǒ]r¥vQԥ]t@(A?FyWoսǻ7Q.߃O;kUk B(<9Ԃ0l( -"`6d}XфOf,x-G|tt6:턵Q*POڎGנ#vt2pLUGzxlYzTU֨`saxQ?y$ C[.~}3t/xL86.}4Fd̷KV'9ZsFA/N}g_B\*NrrQ-[h+-W4p E]ҍpJe5]R)i`V*s(œAZ)2[ޙQVQc3i:?}{D!Gâ(edbN*,XE¶0gkl:fGRQ%foIs[/u%P8/-JCH}\8x{(DklÏ{)Z42ܩ|f>IU/}Azӿ]Xp@sD5ݕBt"*ttpoZ;,(Dur3(+|."%j*LU5F_?yN飩yˏZ6wz+y; ~'ŝPDďJ/zE@.z,pQ0h}_'M!_v?ongK6>v}n:kc:7ﶭ&Α@G.ٮc eT)F[8U;&>L4g/,13T#}2Uf^>Tpdj.Zn ro}05`Ɂas[s)l9GG׏'[[E}"v)f6#tYN fvzBZC J>3pgώk灃WL|ӼUUZMuB&to'ޚB:_giw,;AkwQytVA߾\P5>}7F7~Q^.uj-iY ,_ @m+UʮStzEרT]b:@}r:EL@âx{:,hk[;)Uo&WRh۪VHvf ݧ>bRj{U/r!` )fXe%ux@H4Y×n2eM4hbPD2@Վ^;i ؘ?n:LR]MuC[U1;L[-cXCJpIV/jJiF]Lsur5>TN>bRNf4Oڵp(4f,piI]O4pR#Q\(UD-HO3!_ *+߮_D9`\MN"McpR-$ aAk̦ʕr];.IU"oj&mQLK005ij̗;`Vki4Q^01}xXpgtWQ8)^ǵrHļBxVW` )OO4ҘI"47AŭD^ 6`9vP(WEp($|ne 0-&ga.ObXVumINKs:#)Z}{#stywPDҎb[VH m;ţVnNk!A\RbtBh_Fxa-rg$bYK=8ad %J/ agʄIטoO՘1"^&уctT k<eb==:h Af3.ˤY~Eu1UoY4 [fE 7֦Z!g2d;NPh]8Y)9%R)Iϲ:֖a7k,}WMрuUf auXt`aҖ+ I},6hw,Fl*ștZxSd>֐>ԁ.>cٰ(t.%n+Ӽ1>M6NSE̼4xcJMnɖ٠m>nh"FZҊx)ia Xoq{i[O-R}=j_.6R0#` uVt2}͝fb_VhO ܿ9)1d&A u*}Mb(2xO4wOD0q\<k5Vylb7,%LJBL*+`cMZԻ![ͯth-}t4KQ1YPY JxNP|d@"<D5#rv:-d%&-6ޚ@q4g0c( YUGfxƕiQ#.ᐖQdY ͅ^gr"9,`Q`>5g&CLQ0YEDŪ!aj%u]WX-вm-&yU9:ΪO3}< :!23G}|g89̹&Ĥ5׊(0z|͟q=BC8q *i`tƻaʳ^|}_,Eb ksQ%Q8BKF^-ѪJȯE3sabBy(WEWs%"t1\.1MɇrX`5䥾UUV0O(YX>l,!(;)PAw3>G 젊 g ˒2+wb@ZzKZo(7U-8ݡTQnciukk2-: )s69#X/{z :m%nJp=JTAQD&{Rplrbܦ#ad6ǎ˂ Zzv'RSa'مo٪ҔZ=եEɟ+/-U%!^b>#r_MX94uo/"wz74O?> G{W5ʻ+hDI{x<򌥯(JI \-Px0]ѓKqFnԞh8Pa֠Jp~/8 ؒh>as JY' 7IV+fJbOWgǘ+:*EfD '(>.:jw@N3D)^Deu'bvr}a-k+Ģ[ʆ:nXե0h5lhm7 aސBa`$4G~]pD>#S {[ӭ>ќBs$c`Za vh7d]k*0:k*,z;Gk-a<';mڑy|vzav T͊?nE^+R6!I1:D4wx C~Yy Gz1.g潓_@;?^wwι3$|/9v%̓qbA -rئ},(j˂Yfj3]PFȂa Y?^Mݰ3{3p[UL=<X;-"4Q/v8,l1l]dzB<$%[n(+-ag˲*AKΖYm~oY&ҵcq}R7&R+SQaE+yAu%=*Sp2$eJ.+j̧;2Y #]5}֛?`[(i+ f5ݚ߫EdIl><H@S71_sڀN@_iJB(s5 2Eh ?7.nn|> N=q/.}yƧR )`vN<3_*=Ԍ73j.*,Kz*3w 灥k3pԻԙqäޯqK!f@w5,.zsJ P@_ެ4L)JcKaA9Rr(jX%"gD_|rAc-~M,(B-Qr"jws 2ZŌLXq59YXYWEFPmU *IJBMR`QBBg1PSQĻ~QpYlf1;hw:/*;{lLݦ.\ 9~~W;;33{anH@HJ4H2TLO9o@T::qNd Zɂ,=9=+T0ي7\TÔILM5V`^2NdI,PD HSmAKfZ6agudXn^Q rE{u(:i ƕm/-f[՞gf .m7Ϗ\u\mPa4*J&\]@_Y<_Z-qbR}פ,0a%ݽav/|ҦW!OM׋N-P^;Ĩ6u@|muͩjq?n˭vKF(1CiHJz17JRHv A ٕ[8 !Ȅ ۦ3Rx,3^/ s$sg,:U(¤ޏ(y&g U.c۴ΡFzyy͵aRzofh`f]ȍ?Q_|RIGƖڗ^>v/Y[_?tn%v)ZabL&vaBArg}F jSy b~vu3^ѾzҊ\c"& Ǥ!w7.u''˗ E]h`5zJ!q ќ~]1=xʲ[Me%YGJ'k3$5ϙ~y_1Q{U!eC3Ge@K( [+wjGie [DaeflhFӮԀ:nwH>=I89*+\,{תOPzo;k)&1޷J1Iqcb.0@1H]Z@SjT{#;H6|%J7%Pʭ4w7 ~JfH㮷߳8yB)oXئ73fHyM0`@e$QTPl Y TN73Q`nsX_>}րV`Ļ+[75=bwj'D0gF4Qz%f/PB,),*G.^e65C,a\yfz ]=4*դV=xPz˴1 c %+-hi(Y籪|M7Ck&D|"9Wog5蓙/g4 Q8%3}tT}vn.-i}z-=sDd'["ca|e;i.ȅ13>ԨIݙE`LtxBMi-M{Tc=dqoBIzTllz#kELCbm}_vBy,}4n ̶00Kʍ6T%EMU[aunc7:JݮdY&W TQ%FUǒE Un݋ݎ@韛Λ^s)/F! kV9Tͳ扫9GHIiϛۏUB#oQ'ZZ\5p$[rh#ŶI25̆^.YyΔ)O-= ^\sj֡6:l{}&VB}H~b;WϠ'oc ϬdKT_ / kJzJ7Tzz IB9qNY|WJJiS8*^Z)i :n&oi2Qکث:]g$JЈrez+uj]ޏ`ph{T:W,R)}/↋5[ʢZu'Ь]<=yuⰹtsJNLt[B:nfsOA+;gLKV;s einXslf5#eE(Qş/0Uy9lƼC-֛hf @{B}_zF 7>)g;3|TW3ߏ[5q[;z"ےWܺ8hR&١USm]ȭ$TH^47d %=?%FhXVlž JDhR?ɧu.er_)vY~x n p_/l=-eMAշtޭ-4} ^e V.ɞytC j=&?t1P5M3ά3w&kE"P#ϱܱH)M“(չ;H:}r1(FSv3mPSs8PV6!-S^w~KՁ 5U[,Ѣ;_q |D}#̷3̏2-Ի[5`VEImG({-^P,^SKP$'85'44N|)MZgOVӧH?5^T#NԶy#uAk} )-cJ~B<`u${+6VTmCOmpvdNyk9w5lǺgyYBАYA?Ύ lhLyRb=Ewp<jOQ誊QQ3)$.h똨dl5!?p\=+1(pl"n- ȲG=5|KcyΡWbve爢pu ,Q?,7f^ȼGR |ʞqNp:J\gj5We%Upj'3%~t^O[>)0K ťF{r10 g%): #?E\r,9W h>kkVnD (̡0$L#<oL}IAXtwjmA1] \E,Vz'}ژR'Z#P|zQ]n[44ǻZ@U1A1`g{uIpܚ ^odWrd4Ռ7sI5+`ؽܾo^ ؞YZ8IC@T ʝJb A㳛p$d}YUmtg h6h[]=d1fIzo=™MUqOU^;/e5^:S'?K,*=kjh k;\$Wsm{]`dZ>{U籼go3#_wD^lˍ˼N $~w}sm?-5A鑉EY\658LkL#~tSe׍[2j24EGXGK@1 `k5;Rg9r*q`Vw 1 /E3Bss;h7 jrQﭮ;h0>X_,=enζ͉)b{ђWAJ[?B*44A$CBU/7j0PS`( T6kAC)Ԍenxj&(MMhs 7nNs;r%WvF!f=wx^}Bp53\_~?S쎷z{hVBbGMFWL$D=uƓY& 5W+=,([V7uQ_*e;| l`[/Mxn8sVlRiV &VwҊ:sfu9+ʲ[ljv6%-jʱn}[Ȃ/_sX?4An] u4)NdmFLp1שيPE`G投DZ66ŎLds8o{|WR< ̝2Of>*O /0FfZU .ƋN@sa9\AF7jD)S+ 6Y|A''6 ۯũH/C0]bhߛӘ$/ckB8k6N{h[5 lY )l9jxhݚh^{K 4ҽqo摙?vJ/kdgutqmQ6/FO=gDe.疊{"*L4_$̑.hzIl՞yӿ`iN*7C%<";-zT< 7^&]u|5vZwxW_Fkga?3Q-ƾUyŪs:sbMS?9.ȇ3撙ĺڏUNKh4L2"E<hְk憎P){{^.X!&5 H^?Ye{BDRN[ɭI=Oi,߯V]RNa<;]!04{<"S%!~ #t]?u sMܼh7P 6OE5 Qpk+ebg/.9:*as e-WQOMu".Uh!{VQ֕26j:Ds|8ϹTn||X}5psrOov҈+ggY $,+g:aLpf&f03Л@6HcIaݿjlFѓV6J @=)E%4`*.9"p09h\^. f*a"r9[ 5֨m鹳Q|ӲFP:0 R[BU?aOyM?rh~6ujoA5lݮqb!M Nɝ;eUSREƲ-_&=zݝGNYR-gi /#տ\ͼ+t-^Lë a78g}''(85&/mCJH;i<^8n%cIJ.Sf kR{*W/#q698LWK :U@lugy9u8 }Dm5XhBǿ@MفiT5? 5+]3Viks{?kYeG ſXP`zn,i,-NC8 1'ʧ1aK`b** Kb}3 ,>W_=rafgXzL!B˜*Ukܸ(Zy e"0rތ<UyA ̪G~ElKV. YCɳdN˺̏2mJ \[~pvpעXfBJfڔ^%8=96㝔vPk>d''pvkI:&x2DQؽ #1$&L&31(.ܺ/: 2% Rl`i8}晆i+wi"34ݒC 4#`s+X,4[dǬX~P KR(WT n(+pn[t;.eGCwѮaum[vE;U=k9ho@%&-7;ʇޡPF4Ja"J+O\W'{U&q!߱sP֋B $$;w0Qfhu{4G|>xp] =|ӄ[786d7./?|?_3/_۠;Y%Q%%wNxQ2䎊J2^;bԺd1 $v ;.Um;Pƣqot;qfST˜SY&t2LJ` RGc:UϘd* o2h\&?I3MOs5J]lG A\ߌcp'J:grDYLi&`΄$;$I\$ %ٳݓ-7Ϥ L(i\ lj6HN2DR$[{XY57U0d4vk|y6&1VU6)vz|~%N@O :u:_<@3Wju^GNvNgUY`0_Gf}p @ɵM#@}A*58фʳqmIJ0:a")dno67 4@iB'1aD)c 8:aǓYzF'i<0=ʊv28R=T͉Џ17BiLTTbw>flvcf@!rէ0g,-ߎACٙlևXe`/ӈΥ4EaF+${L둩&7Z[`)kK52BՅ%P07H8࿎_"  $7 v'$}H$'Hm'H/kdw>{$o'63?|ݨyu48KhCh<`'MF4M}(xNv9͹"ԷWIk[+aiGghot0#H A $H A $H A `3 H!* #Z ׅnyH I&w@q B0F[^]8p.@z.BƈPƺ!xO]-- S1  QC]|F!x[AGta z) J s" GW ~|\DaYeيbQbNBVZ \EV(L"QfD""QH^8F(K/3O/QE"ň?yVqnzS2YyaQ"_$v%P RʁlH (rk1 (\u!Ć\weAe A\"(2 \dvonZ)1`O , 9rE-9Xz MRS{*19 F?][^dp&iFie+H@, #W_*^sDE F4!ZWT'Ց(LMUijfBj&Uǂ|@(NCjP.=xu8T QDX~ j=c Rcٞ[D$_m4!c啉 RYYsPaTV,ir7,j੶y}%Iѿ4Djrڼ/Clߤl [zd(4ā`Z_ٺHZ& %hyt7Kc~Z^wW,#@ @uzZ @h*{Z}7zxGe7@z?˛pn{ZetO@_.b;F"9^ @  eoߌX82!` lycR=a'v]a7@HX X!ֈ⌸  'x#RE$ D`d 2\AZH;y&>/=XwLi*XmdL4QS` R2Q p&ڙH>Lw&"0V.bB(@8h8TR%HC\<|ZBuDPq1ցjv\h[+UC[ c@b ܌&atyaNbNVHVX\ʕ%Qb#uepEg]pg%sDez^AN~(Q^8&'C.JP(bO\ҙ96N+:&Z6P/ BT>ps#Kp-pO\K%^^^X$4:&=խB)ycc |6K=6lz]<"ȵw?]ƄNȱͣIiw(%m!:R!<4z)SH?_>hܩD?q4K4_4 蕞4n\\{VO6S[{_f]Ķ:JŁO4m~LKlE{2V hi+Js(En8Lukr~C:ڰaRsϩ?z6K;^cY܌ \! U"0pey}#;eob#mV"y{?m]/=2ܷ3D&/~wH.JWʂ"?w7`s@a E{aAFQ\,m5Qo=~َU0tD i-|ϝl{cQǹQqZO;nMͱģθ+2DgRwþkWU!~?{&5L>#e[o7}ףӂG*gv+w{vŭK]l%^\5s>ɫw[i,y2pNKXەVV42Xt'h08޵Sm4DQT|hb܋"*Ō:EX gưQԇ0;]P[4Rl1&N*Rq&a(B+16捆YSXPҴζe"\b=c6ɢ;dqArd}WBl[ׯ\{ſu|!!ImS>|~~R:gmVRG(}B`UN+>f=ԞqB/@wVT/'PQ) 渰33Ea2G/-:;t+9RݥI,qWKpC~Ev|^p^ackβɂ[,_jd^wcTaՊ#*n},<ۺp.g-:粋)k .k|܌~ץmsUk\_Ԙ8^(X{m2 +̤ nG#8+)aZ.tԕ)c^HsgˑnO N}:uWooO3(ζ|G&3-phJ+<`7傮+Vc9 n.?`c5|~:\=}c`KmIV,g4[u;\6UG~Z-yb|߈gD?8gcaDq~gNyt[v2OO$+Y;&qm/X$kѴ)3do~s \.ҘjϿm-^ߝbׄcyol_m:vca{/xM `i٫?X`Co 5`vk2LXjC}T('p(}|ȳqIm]y}3L L?0`HoaୂGpƒ+<p iNb0TB9p00H8 V/2f)NzlWTI'3\5ٗhqP&|/uqe>V.luwriN52?5ՉޭN޵]̖aoi=^5fwgl6To)ٷt$9~]ȼdF~hՁFA+{0SN_[&*X]+P˦W]]鈲Fuݑ7V7\]ꢨs3g޲L}ULڅҲ}̒U$60f:=N)xv?Yi7hhxḗy;M>˺aF[w}@FLMg);oӷ}[\x7i䭤= }ä{')%ǦZlksir]˜jֶwfS,Ȯ>c-deH:cٞ,{y͍MzY||2yӠ^]X9f #S!:>b)Iӛ#&5\Xҧum(yu=;9ư/%~9SavNOXet?yS=}s9^6;dË/In g$@[UflM?H>)N͟LJTWդ[c5`0_BS'>U-0<euю Fhb "wMwS@/z$zYwdӠ纆u~>r}RhmUrA~9HѰ^GC6I@+fuÓ.si BlJ*ߍupv,jHyܐ}.iI釺+kl<)^7yܡ'\*7{4"ofΆܖ{|{sM9٥3'{4o|GǬ9g?Ga3+oXR"S#` o{x?7E[]q 7xztT5ȧj'϶Ig|j'ᔴ? SӺegjr+pA)P4 %C`eP$ʇ5v]Y@U^]KSP͡TteB ZE(Vrw|9qRxA<ԐIc-v¬S<`iJذWhOF*$Y͐*Dyi[rk?Ky@ܸ{e<i Ib}ppe{Lye|A{o,~&l(öSSgdH]f}t {ճueː6)F :@TQۥ!bGg\4ʱWWs찚$7ȱ&Fx7)M7*^mmN!/?܂1mWwP;9c*j 3z)}{CVAs׶v;|> stream x\TTGW,U*K XD[4#FQc"Qc%h15bDq- Oߗ3{潙{{yvD tB#aDjlO! !ta B&eѩaSL?L:1M=ckVI٠)s +QBv {!d~YAC0Bj,T!RAV]P<&ѳH_]'=frW!0J\(T^O ŐbidyJ@(xodt++ ,/]=.-VT& }//++{>P?]6l(! U[?D+WDQA8w܈%kS(!%_Hs,"7yRHځA|JA RF]wr:\;htjlB" [Ci;0 tt!]P\?vde &_ _Jq܍"8D9$80?$n(̿{;;RA$jQB}Q.*Ge2Gݓ]SJ|ઊmd-%awCz tu45TUXH98 uFEfF&gʳYY 6: # #zJfPL'gZZ-´k 8 %lff&Y˩3NvX9kf3f=;"5ro~nw4o;E_"\w(KdVLX8e9]h-@hPP[ƒ3#L-&gYYju맾O}M 5'n($̷n&m%4 M3{ߔMgCYV7= 3#$94MJ)mV Ѭs[P=Ch!vE<$QM))FJfiSVn\  $ ("ѐg! AP |˅4x7xYu LYӡ~2F7&ԛH}!XP>((@9ʑPr$  pA9 &xH Y0 ;&@br A7(B.P'Cr#Ȝ@|6 $f/P@ 7)Ll Llo|P=h- -PԀUxp,Y1P!Q4A_ )dsI=M?<tuG% ~a0?v&}jgt_Uwe;"{Ȝg/PsY4{:͜bN1_'BdIk8y=Jc#! L~E3_/n z~Nv2;VzFog-6ӛMF3z#)N$XMb?V1+Fj%m+eRz]B-f  鏨f>9ˏ, 4J3S{$~%g j؉t3@gƱcqL5;fFU+)[FIRLY |#+#9l. %%d6_m A!id*B&M+IJ1t,MFQT$LʆСL 6?֗GS.XFs J0N3H;1do֞{36-eX֔%mXh!ef9cJz҈5CV@2z.j:6Ӛƪj L0J,K+1 > Ѫ4zYqI}Mx?ˉ@7*(^^7B([N^*H%zD'][l`Ga7i#>1ExIQCjH 9h;@mOЎ@}`! FjTYhA&2v@N@?#o9'<&;+(e{7`Ϫ,4ABd e㫈5h-RZI"roy>n9rA`18Qa;g;Á%Qw#Ҫ@|XG'$F^r dCBBP-f@L+uSG!(` :F8'Q>/"zmAb+K{4MoW]}أV큜Q0#[uh&B E܉>{,xc4/y/'Rі.fE/dз Hs/~g7kme]lB׌[WԄ1rp2e`ajWbiYZ'p!VC Y ˆP⍸޶j,K" )򤱡9+S5}*&*_SQ16Pnmv%$BZыoh x2 nzkVtM躋w1l砭'7R7r* VQUQ40%h ]0-D&&{2 ȫln&i"L??Nx}l+{@ 0k6V69ݘ!R%X!+k;Ӊ~vs8B"VXӣ/tF#]]GsCM"vdܢJ vOK"ѕ&fI5zQǼt`|ߋ.M@##N^WJ3~&(BwI> 6%x0:ɷ6pts;jD+-J@0a„ &L0a„ &L0a„ &L0a„ &L0a„ &L0a„ &L0a„ &L0a„ ߓBF]ϹwPR8_B V)6(K: [y%J<ZJ~E@D"O"MRSi/0PٗJhyW^GxE v~I>>e++\Z6Rh \, /TJG SJiciy9biaY_* *yyr]S2J򊄒%yrIn^|xP:I+Y,)ﱚ/HZ*rb ABT '"烜ZT S[F/jB>,<5<RHror+)BP(*<}\yT)T"}lC>%rpm)[z`XXӀ`-#T*cW!Z(KeRdhY,M, td@:2EH1PY\,C2wy$,,ȹeYhg!%Hs)K"W`AWRSR,LJ.N}¡!*5$#Ad2yt`)HS5d n qQJ!H6飷ꩍLqA§?:hu﯎/*rF~(!e(1 BLuBN+ZO0!䧰(z>C!aN",!! c„0%zxAGqd59MH8΄ JxQ#MxҊ&I'ҙt!]I7#Et'=HOҋ&}H_ҏ'@2 -;:yl'o?SJ@S7CR~6!pW`ՙ$*Sb< Ȇ:`!Y. 0fUX&InH88fjPPT!?#UB j^Ğ+;VZcCu:Ovo|feT1`UFO.Yp,N+/J-*(&UVIˇ٭,-q9s]5J򄩕aj^E] 9֚mb77mȸz~8kv>3o]O-`x>۲3[|LצqI5;AG}cgZG\W MJ~̺wlҵi_JkiT`ڊ~w(8q#gϘ" yoW=2DF8LwYyAX̚9H,M1TEe6h7P$A%C'~3}eI sV,yu{LT߈O2w̟R啗YY'T ++*ܪ\aQ.ʮ92 ('lʔ^?n=WGX>-|U jIMTJvsw7IYM7>f|p/[kyZgd渴xI_pgȥݶaM~ޜLAi_jxtv]G󽦾}`>I3O niGef[]Ȇ(߂L _76Ss~Î NW?G1בo \;X~`+ ]*VA;EƗ̶Hr]8T8wsH(mjr!2 & u9b?(0&ҜWUTJ*GVp*0(z . @g)1Ĕ'9n$ahGVliuN ̩L-Hv[VĜlghnU0yϳ46黻c\ΘSV E[Λz!uwN]v7Oc779"|~ԉThz3TuBXt-{*D3 zsj@ȉsz8[ط(\Z!ͯK\E8.eW%rIeTdYt=F/ YY(-/x5DxŜH.R C˲6 +>=q,!O/_Faи%O厹aᴋn/b6{ŤëZ3Ek_KŅvN9QߚieM }މ}/$%ƭvhK$3u7:~0Nt_GLw'탄:K*6[bo2dyU '|U5˸am}j>\I#+Zɇ[Uz*ҵ\j]F{ɲ{E˭'o1\ЮwVLJF?6t:fW,W;̝:_6DzٷJ+znS|+̸DWh\7Ѩhﳓt :vzCN޶.VNY87 :R6:Onk$?◔_=T/p0{֜\KԖ7}w(n^m[({]ٜsgOh'׫67^ӿ]9t%ΘF҇5]qiQה]?rE7*&`ڢĽz3CX8X`Y~{D*rkDjfTT3$έ?ڜ&TSJ-vGL~F39ˮf,Ʌ>4~Rx(7W~5Q& Rϫq d~:Ɩx[f΍H 7V^N38P? POWIKM?k:]Gg/1A[ 0__[Iش>ZF._},oS&Z$lu+8EKv1Nv}ŋ>]{Il99hj]sIeќc7pُ}Z6TwJH|Gv} ix^cKԪ:mW꟱h*Ov75iCZam\5#5<9 $KB_PQ|C2(m1qqgTU}6B-&_l1\97]t\;~=rq&]JV|huޒCrݿx~F2{Ԩ.l&-EK`_Pݮg͌3dkE~i{5&p)76fa##G+6}NKO6:֞HhL{vٚbSY]qkVnʯ^'h: 5Б#x/LS>Ipw,]yyswv86A-Qb;SŁ]˭ڕ1_ugeF>T : *>rʋ]Kȿʆ\riȜ 7qxR\AS._=;Ҟݺ|;uߛZNt6GKM5,ZJݮ6B͂sa[jӁ7̛f>tႹE鈙v,d5{/i V36/'T# hn45X?iC:O;Zo֐<Љ|.2Nw akd߽lg`'# ) ++?6Ԟ{ޙHboRP"_?"(Hti熓wy}T:`znK$.Jqs,J@(󝅐+Wt>dS&-(y}[Hޕ=7<-݅gE'^vhyMUzn5nRZJ&,(bBWhUj>Ӣ Zxmǒ U X4`UC)iI}P=^7l1ޘ$tu{AK?Q}tm}015/Ή Kvf'?nFU5د-[|jDFXYGsud̋aEu/<3o+[~g}ugqF/OXx0_{$H8wN#|SJܚ' ϼe>~w:G,>2%;N+_RFZ!8i5A3Zڍk3ٮ_n2M2V>>$ܖ2'G[==EewKs㤜~֫=ƕn}4O<]+j7 endstream endobj 63 0 obj [226 0 0 0 0 0 0 0 0 0 0 0 0 0 252 0 507 507 507 507 0 0 0 0 507] endobj 64 0 obj << /Filter /FlateDecode /Length 79828 /Length1 172680 >> stream x}|TU9NLf&ɤM0IH) 2 @HjBTCGP7VLĀ]UWWwme }9y))$d1.:6gSr+jk \صM;+&VfjU3/Ul~NܸcY]=ۣjSFycrccuܵ}iۊ/'d,{[Ӿf7x/3eL2ł_]ؠ3'/h[06;,Y?ޑ]Xmn}B02@e ZW *a,˿k_>c:-Y޶K뇌-iK֭H"߻mig]ƬXrUt]+94c8&|?\{W, n@ol#7l܇)q8zZKgF9Xdyv_T].&5"4FU)v(:UbJGee~ƎQ7(Y^o{>Z<)Z7E}0 ?-膱_v/݇HHH\-Ou_SZ~y/|q@'EB$DB$DB$DB$DB$DB$DB$DB$DB$DB$DnֱexecX>+b%u.Oac^ d}_A}߰}<=~uz3'JwkX=~~zBqIљɻkv̝3{-́ƩS&O8a|ݸښʊ1F,-1 ?opvVfo'1۬hTվVo05'Ҿ6Z^j~\&mՊy\ҏO*駒%[{}U>o/ tuYZ†Dz:jxVy[Y X-NK`cBZپ=<{ ׄ]=Ga&mPͬnNihrh6V4TZ[E|o:ؼܨ_G۬چJjuw֠37 lx7쫪؄'nLC}?-l1d:bBG<&K7ϗ.r~C"^6bܖ*rW@l9'PU,L n k_B7fk_(WUE~kj mg),@V<"ᆆ`oE0WA`1XجU W UYk{VJ[ZEmC=ü=ElkWbP;=fwz;[(C]vGҲxrc۬1Z0xkpU!ÁҒbD+ʼd1%\BY9Ndj8wzK:;'}fԯ- 'D]ҢC9Ϊ~Qpít?Q$sR3raSЌf)f_Ň9,MZ 3ϒ(RAlP*1krrXt>wRvv|Ep̋6dյ_3 Kuxkz6WT.)utZ_6oroa{*z|??qF~cC W*[+Zz2׼ߋ]**" T$LZy~?c\fi6qޫ!m l:5ąp1jo- [[bJ| aA7+Y*\nv#&pؓ[}ا0TTE޾݇[1f3\(W+ smps{ 4̺L[ hn%j:b:R;ߌDpsK%WܴyQ6A67Nmč Zc|C`*ȌfZI(݇V/c퍘괗ZdĖ`q3x,5jh_B[Œg[ZZjkZѣ~ WwU'(hM":dDvЖY׆͟[a&GXmbgIq8Cӥ$F)NbX'Z)HZURT)VH\eR,b8EER,b蔢Cv)I&Es#l)fI1SRH,t)IIF)J )&K1Iz)&J1ARI1NZ)jJJ)*+_r)H1Z2)FI1RR)J!p)&EC"ERK'`)r$ER "KL)2I1@t)RxH"U)R$K$E RK"NX)bpJ.E6)Ja,I )RPPR}RKqT#R|'ŷR|#R|%ŗR|!ߥ\ϤTO8,RMJKJ),;ROR-[RQ7xC?HI)~'RVxQx^xVgxZHOJKJxXxP_R엢W'ŽRb!)zJqwKqwJ[;]_KKR&ŭR"R$)n)bIqHqWIqWHqIqHqIqۤ@WR'V)Ε)䱇c.=\{ ǃjjB {"R=?Q9C4J"IKJF'*ƆQ+CRcDT/h0Q. ltQ&A#@My(((MJJ"J %O%œEGX"'9d&EQBd<J҇@:" 8ӈ׊c(R}C5W&ЗF;DQާ0ǔ7W> zGw)JC'$zRJz50{W;~Ky2>OѳDP~CƧ$zqǨ䣔z Ôуd|~Dz}Gt/^=rP(?C$n$MtG(5Z5.ItѭDLt뉶SuD]Ct5URW]At9]F\Jt ]LtхDۈ.SWDm%:7jrM%:̐+ra3g\AmiDBzh-DVR]TT!W;h95J.%ZBETo!|IA%ۉ%C=z6h&= jnL4;nV5)8qɡ81'ⶀCqyTdPRjX;T ŝ mUbj@cDDcB1xє* 9[@Fbj!g3hx9TLyÈBTrH)0k(RcrlDYD!R@mSc^jCFRRDDI!lPb1rbb*8h'&EQI+Ld"2JȨ)D<cG#w} 7Wy#) p!# ||^Bϻ_?v'm-~xm5ϫۖx^ey~ [[%E?sg~7S <<u灨.Q+=Vy}E^-Az֞=wZ7yv[Onyn܌:7wX{nz`;uhZuں++ˁˀKQwe"dυm<XvyQ3=g%-sV`sݛg6N߽)`ĭܛ&l:mMon,XXX{mr./ ٽ:[zj|j^ [X]F tV )]]QC] ޾{i5`./.*YX{A`~IGswGd^50dv`فY%33w4@`wS!0uwC`rɤ$K&&_2.P{\&Pg)o07(t݇ܟutt1dOcO╓3.JR/&*Ĝ5i.֟_x%-F*!ڳj.nwy\Jř3zC۹gWvG{qVCFm".}65oE80jJS*rdⷖWy5L^wT.Ooq~1kʝkbS'MSfyFq7 =_Õʦ`[-}ζm,bB09ؑZ2!Yh_}B3iɝrUsprU_-R(VBZZlb+VI㪟/݁/Sf,L`3pp: l뀵`5 X ˀ`1p X,@ڀV`.0f3L@L)d`PL&:`P @P Tc?PFe(`$P #@10 (CB@.0@ d>`x)HD \@ N؁hDV` ЍUupq=p8|| |||| | 8 | +!>.;!O[77?^~ x xxxxxxx$8(pxxxx8z}^`z pp7pp'5   nnWWWWۀ nWyV\1v3Xcsϱ9?Xcsϱ9?X p{p{p{p{p{p{p{p{Xcs}ϱ9>Xkcs_z-tC9o`e?%)mF͗yDeF<~=&=ٺOX(%ʦW¼8 z߮Sl%'+6lSuBǔo;_p;C 3ݩ!.Z1 JEEC(ò|6l1j4E1Hsg}ӊi8A$e:gfUA՛#*LXR=3c2ŤƻRco꣏]}RaԬ jI iIFM:tX3dqFeW:v+ErQ[gw1ƒeNů10f_=Vӟ1$*ʒ]\PbA)K"X{wП`ML$7x<>bJEwWPgr.(*r))hU,bᇹ QdW\"&uљ'&O53/=t%s'oi7mpiנR f)!5ÕTXt["? #6b@FE!wW;-~aKj>˴s!'@FAFS,ďy;"_%ޣi:L,DoEj`ꊋ/:\=Pv7,=aYu,kϻhtZXdtzYAT9[Ħ-3M]W?z <ճWm.*hXV^4TU4/03c7O;:3np)1a.=rGY6ųL<ml縒D}=mofh|g۵k#\K<2rN9؁fLQ{43R3yFJY ^ |ӥӝF!+K[tpt9 ^QVl3# z`5AĘDo#dHIvׯli DGaU:p"3Ykc~[psRyV &y/i(}]z@9Y9V8o wz|^-=]0Ӵ`y^LGmj>OvΈ1/M{1]8il7+vٍutҘ)FՉ2Z:EoJղxԜmk]Rd[cRbFGZ|\ZB[f]n^nnb\xG+×X%w\4+Hfz M[Fd}z;ޞ87Ԫ,Š>MỎH_$3_2OwF N\]YdD /} 澡Z~2CZh-%¢U!C k]2zkC?Q'Bi3󪏇EqMS(6H72m:Y&-1|/: 5. kΌkZaFGo7 ~e,ʬFamb.63y|X[,<#|NXD,͆[Cg444_3iC?;4444444veCY!ŠOktl%0R }֥EPX>rƲ%^6l!VjNp'J%+Qo ̃mJ,ʵKVVvR+a[QEhCEha=RkV^^5󠗠Wj>@keyU(4|OQ‹g\ݳSx:YҦ}vK{ mSs#gRͲDk>"RD؊p/_ĝ |SUM$MBJ&YaGAYKEag4-%%)""2"Ȩqe2YDlk2 AeBY d=IK ~>o{ss<,f#ivGo) _d,8hGZĞF=9 .}ύĕ's;[ּqӈvs,CS5or"M)?S-{h>fEs8bCa6&HgsЛ$M?=rdcVڕ뢞9Hl{=3dO2QheEsÊR?SH=dN{R'CڻW͓=q,%YKX~Yk8elXͭ6#-Ke ^R$͗zd?Η..c@T))5-6dkNc"mMO1(hscn: f4 y%{HQ~咑FzVVj#ڸكVRZoxy{U볢=2ycoMkX hc ϲ넻qΐsV~2pӚ4<"pT d 9h2h5?)j\\}7R+(;٧8yys<ܮ4c6B%fl-d߲V_7fKo~V+=3>Z}ӪVVNO3E b/Fϊ):1KNdCGXm1?F6r9lnCiF;ltFlxl܇G%|/\c&611JZ>CMmmb6`g1 ki2߹ƅ&6nF_lTl MQfb^2G)f\OQNjYQW,>b^1Gmڴ%Fq& E-\fsm\Mb~VYfJt#ce%:ISWîUW8ꊼJ Jt%ڢD1ʲb1*`[j:ɠ"[%ѝb`P,|d0E\"IsHzNb*2G7=cƾb5*36x5tMU*)D,f{sLٕBnF冶}5F(K(KcS׏ע}yfRl:>CY瞡fb6F\,):NLVb2ve3v<e<.\}cZxTeWeuii1+1=aY;O0)C'F15~DYXTYYQ1>6b 33\RXh%s\=an6HCsGfYج)El:˝9_ NVdV.UήF#ZGa<>ch!RRSNjӦN~Ld##uuh'!Ѻy&^$FՐy+ݕo;r~(<Ԋ=r{PnrEm嶽&]r;Cnϙ,rnvnk\r[3ԓ#6 W߃cXq=D{_)vC⢢2Rs$Z~ӮY;5߿5iCX]i~۽q\|V/7?c\վ~"ZuPxZ-"U6+IU?]X{Sؤע1!*6Q-iGǭ6Nw!kyĬY5^PZn1ް9դC7(KPX>}ZR<<𣏕⽣x@|΁\8d{|:d(CvtQ#vre#ߋG\QQ3џI7r޹#ևk}>\kHބ;O7qĭ˒:i,VOzm/('/\<ecZ)SNQmROivm _xjpکiuSg9YYYUYlmUZ*sպ .`5 6.xo v-8vuou_g_y`FoAB> YӋ.\رBGmUE~QaQUŶmY|[W-d쒇%G^xˌF/s/`eW_>wCWVsՇGgW6oZ3O׎$o84J|Ƕ+PWjkmjvGxvFs& gMWRjF&+g<]'74[EVsr'90e_˚cj2brZ6=Ke"!Rﭚ6MFmڰ–A2MSE 4-k0k*5) ^Yڤ\_CMJdm,׷VȵKLiq"W.i&˵ّ(M.MJwzw7Wy֞]b70N_^J]! {:X) E 1QW"@"("ab ,eJh 8'`-< #qBP U Sip?<N1U-:S?C ?$G [ѯv}zذ ހâk( o G?DϨWQQ(?gz%&{=@4w1r! o ɍ1/??%1Kt2GDOfpCã@Lxw,yCs:d@&NB n-:ɾ{~m{ߣ%ц^[J-uOoMo@oM7/SA7c['g>ן~/0*}Ԟ`{#_ާ؛!br++a%+}+r^R,eh_I,le}b<~y;s?vF)NKlU^TLOgB*NXG;v&v&v&v&v&v&v&v&v&v&v&v&1}EcX,gs匹rƜ5.5.--u-cmKbmX%r9?@ų}r|>cLbKbKbKz\_)1|~%ƣ[\]Go?̓TB̖USX1Rs4i5gG)~Nۉ-݃G?f5˩9Q>_i}mi)룸~\'X']>'۠(-D'edC <>N)1e% W>mAпVtaվxV<%v=? s-LY[i-&͢?$&O_D,ux:Y ARSkZCh Zkim w7OƿH0~M*j:sB7VnSO/ &t7x׆M3Z F0VA B h kV@f6m&ns{o33tкSyL0af=kYԛ N\[aӜߦV9Pk VjE4qDQOGCK(dG!; QȎB (dG!3JK[%6A$B{YoN`$ ]+tp-'nd ` ;a0 PaQ0]p7qp aLI0YhWS!U=~x 9̄azVY+P1X}CY^Rg9FK/3Gk:l7`3ބ` *[ `0*̵a;3;a>=}p,2]Mc:Ђ8@ f_ xf<3g`30 xf<3a({#Y=k>OS xP —',Q5vj\5Jf#/_bMB9m>وFfi)krRO' iO9}\~%6ܛw;#vJ}^3|}-myg1ӵb;_P%)V=kj-!KDh#",[ءn\5< Y'f= `3D` ZAka1 CiO3~Ӝ tnpzܛw>p;$s̓f a8d橴KUwiz~Ρ޵4fw͋`>,PL'7_~/ 0944hz)Z̪?|F[|+a3;+Tt;%@"0Gw~Fzj#B>h<";U't_觨;y:hmq맞ф0 ƫ_&t` Oc<]e2 WXu+]4gYx6^%x^W 73Ӡn&nޡ~B=[˻Cv۩r<3̃lxq5@lb [ -@lb [ -@lb [ -@lb [NTOX'd)0R>p I=NľR2 PAM[}+o%^Fe^Fe^FeBu𘺿 LA' 8$ 8=T5xR'U?g`uA.17򎿋UOǻ*»*»*B'8QƉ2Nqe(D'8QƉ2Nqe(D'8QƉ2Nqe(D'8QƉ2Nq T*2PE@"Ud en KW7^B)Dt/Ж, m€ȯ^ڋV{j/H!)d#lB6dA6dA6dA6dA6dA6dA6dA6dA6dA6dA6dA6dA6dA6dA6dA6RF H!)d#lB6D_'b?C 8"Hv]䦒Txr"]Ŀ+++?*?*?*?*񣒱T߾fc Nyq!e+}%RXaãJ`<hen27Z̍VF+she^2/Z̋VE+yʼ2i3{1c>򦽧waƮc>Ʈ=|{=|{=|{=|{ߵ9kw 8giՈDTZ_B+q5PfZ)"MfX69nBW(K(K(K(K(K(K(K(K(K(K(K(K(K(K(K(KT "ك6{tN}A:#ߌ "v_fi گYhۃv{JJJJJJJJJJJJJJJJqV= `3D` ZAkhm$@"j9#u䰎֑:rXGCCa0FHa wX0&@qdȂy0!r!\ܐ(  =Y,mT/ЗV'D**P!Q@a'Xq8Ajr,Xa0AV +L& $!"!"!"!"!"!"!"!"!"!"!"!"!_&e_&eV \U.*d Y催rA"!"!"!"!"!"!"!"!"!"!"!b-wkcq9]N^%bI]K 9c/=;j!'Ib"=O|?:E 0a|a7UQyȋF^4hE#/yȋF^4hE#/yȋF^4hE#/yȋF^4hEhtNI4:F'$d!~Fg!~Fg!~Fg!~FGc/{؋^4hE 4@ 4@ 4@ 4@ 4@ 4@ 4@ 4@ 4@ 4@ 4@ DA P_ϡ'ա\ա\;Qϯ{sBߡw( ~ߡY@? *֠b*Qя~TCE*Pч>T}CE*Pч>T}CE*Pч>T}C:TC:TC:TC:TC:TC:TC:TC:TC%?*QɏJ~TGTATATATATATATATATATATA1B=*\@ (Dٽ@v/ dٽ@vd7Hvd7Hvd7Hvd7HvCܝU?]S](#8⾏83HB̦*K H $B`CwT;BwWO;%<]=ыs}Ͻ9u<}~k);D!QwCu;D!QwCuG>Q:}NuDEyY>Ϧkbt^߆9QV8Å>T0i=LaZzô0i=LaZzôO.Zwqٌ˼ J J?X >Ufm]~tُ.e?G]~tُ.e?G]~tُ.e?G],SL2,SL2˼JJJJJJJJPC%;TC%;TC%;TC%;TC%;TC%;TC%;TC%;TC%;TC%;TC%;TClʢMYN2+i\qei\qei\qei\qei\qei\qeWXƲ5lek,[cXƲ5lek,[cu[27k,[c9:H,[ai׌z:OԨ:Sޖmi*O;esQ&0]_~~zYvGfL SavjwhE=SQnv;6s9|ȧVژ/:Rktys\hLqTB(tH)ak|jP|FؒP]r?š-7 bBn4PC~3wxenovM|awA_%aWxԵ)Z bڼnGzBGnCGؐqw}BhWכWaV܁C~UiCNmT-PuUwQuU7Psd?%)OT )C"7Pp@ ,R_,R=`E )C n^z7HAPlb )C~JSRT?)O~JmدTR= )#PZP)6B #9\&=kqv8t>΅upl|LRTOo?_aeI1YYylF^O;|c:‡سŧ*Qk}%fnͭpZ%zͧC}Uyuգ>| ?}Sf0U[Y֮ObY/EOaUyU:a:m,U*xUbX.1"FXx%msZ%wEO!>abCvzn]<=?wÐG>5`?-W ?$,CmqP[n7:3Qky"L34J񄭔WH"Ol`Iͩ2bl g78.\wxݣ{ joO5SVPwmJiMٔR{P{R}Pk(6-H%UB`#?;[%Qc}MXTF:?DYa6j7ߎ9¢E-vv<OWm?*{9D^TZĨ>kk^^k^O|[Ė>}-}:`bEX'VUe8f7R+Sx6N_p?+؛Zzmư"UDڱ թ?;nVfT(;%^yݏ]a,rD&{㍰21UHY[iq*fu^xvA8`l8Zfg˭Wo Gyh}3>8N; ]xq#]dyĮͲk,9C0>,8#̈?1|<|WOGxe#s1>".7>4&Ⱇ!7񐽬d+Jffyg%~_h\:\յp9s:01wpU2lF!wx$ūΒfY,p*YnFgx}\[^Sr=ѵ'ך͞Ղhu{Eެ{=+9gɢ3xټV`^;u;^\?PdžL_ {9oQ8ou1;5;\aE3B3Uu4^z{]u޻9\gTgTgTgDz<3x \+JXhf~n4 t<;<{)]k_sy?_\֋E|G6[+׋惲R _z?aI^>ɳn9%V*v9]gb7[ֶ-lmu-j Z%*n)zP[+sgG7آ\³* JoZ§EvѼ=L6SM<.ro"u;e_lcxM4n[EV6wldX-ElYD&ͬM7UDl[ۨMl[DEl6QEkZD(VŊXAkŚDQ(ZmSQt*NEѩItjDRQT*JMQQ4*FvE]diK/ڡE͢fdh.Z "CnTj6vN5v;"o-<Ƿx{o/"o/&^vv^]J]}Zx= /Y?Qsx}kv6}j_Et#bFL?9|GX+ZDEy7j+ʒwӧ>iVּ5Q賈9,w57X:;l+2v9neVmeV$ʚn5]2&eF̨یͨlv.6ni2J/cA#m4v#m7R+=jlfhF4Z3-ioAZyۍioA}ѷpax+bկyb2w[iwJ)_U;=v{Gu~ge_}ႚL=֙D5i ytgZ&T8/x {֓x/hė jOZ<:q37ӱ_o_9 G>*=w5'gN}ÜvgwNi;c94vgaai>c숎VG+MQ6OG44U){W/NJ_4r.7iDcW2'8V"<׈1f4R[W#s/Foޛ]k7M g+y5jͣIdarXaIҫJ2]I#]I>H#۰6,G#2۰6Hd#ieae8#6Dήu5G~ +']с"':8syN;ב 87Br?%+ʺD9~~`tR+ֽiV>0fEauV6`eV6hk;Hela_GGNAntFiizTeqWc=Dsz̜֠[TvN;TFx$>Op&gp6>g/1>:tճV67dn|t8[`2L ;7|(P ͵1Q4T*1Ȣ9p0HXY{:g:>0<^;x֘C߉ kC!Eaǻnp2>p>/8?rbwѥa^4?eWy!k^Țտkc6n 7܊p݋B~W͆gtc'Ako542,x'Nt` ӧ9~ wp.E.s˹riM[/ ZX6э9 7܊۰`!Ch-XVl /E0A abqb8XX,N, (aНT'؉^:T>!,ofĂ _9Wo87,p9~p5[FehZ|ŎA 2tЁ=kGK|g\[\ި::8Ab *]\'&qNEg0OeSd6>O`6>! W|";'ϣ+ \K 5ˢEObkŽ^aGхvt]hGхQwivu]fWiUwuUsq=7[,Xa1xCXz_t`h\4O05pIaVjB(\.R}6vTxrh%zGxkXoSlYm !՗FWOOp.\)a:f0Q(^L^X݊8&Or<Ɖ)0U*~L?ŏcB-[J֥2op ގSqNXӮiWiIсc&fF=EoM2{Wlsn9 yLO4&`xдpt`ذ08G-8 G\k͵\k͵XxyӜOnjnLUXF$-L egdMdMdM:\ٸ֛ 7܊p;܉ p7蓽7⧘Ѷgu:3:3:3:3:3:s3:s3:s3:s3сAuN O*U^U~{eYn.F-CnsYNPTUE@QPTUE@QPTUEPP@I%PR T%@I%PR T%@I%PR D E E $ .D?Ř0^DXDXDXDXDX4=S4=S4=S4=S4=S4͊Y4+fEӬhMiV4͊Yy]mwvy]mwۣ ²HH7777777'֓DIQ^ (aAE"}Ⱦ@d_ /էSD)Q}/ j/ j/ j/ j/ j/ j/ j/ j/ j/ jBqU_ėe|wL2Q^&Dy(/eL2Q^&Dy(/eL2Q^&Dy(/eLK4%V%V%V%V%V%zD^OQ kJrXN˥NUp<;̐Αf/)&1m1m^|v|Ix$^^Ϸ[e,jdGc('d,r\Nr9Y.'d,SIT%tI%]RIT%tI%]RIT%tI%]RIoI܁;1wa=LLL}WA feѬ,EhVʢYY4+feѬ,ED3ufLԙ:3Qg&D3ufLCzn^>!3Oyy+ +.K(gl NS(֘S9g9]Cft*G9>((:(d΢(v[qkt~Z]FQep ~٠P]GQp !(<:Σ(<* U.T9\GhZM_K19WMWM\Xq~ȫ$Gi\z 0L/86UF>m/p4NőWqUyG^/ܠn P+Ù3A_ }A/HD_V&V&e53a \5?Ř?u!;$* 'HIfWUOV?'DHTASTAYUБD%4E%[$zDo-EHTHTHTHTH2<{;^XUMnW5-P5-P-MQ-MR--P-MQ-e~A_~A_~A_~A_~AՕWuU]yUW^ՕWuU]yUW^ՕWuU]yUW^ՕWuU]yUW^ՕWukoNGBCg|\v1PRUhyZvv. +j! ˜(ˏ11EW5|#;'^_)Tzr*/˩r*/˩r*/˩r*/˩r*/˩r*/˩r*/˩r*NJ/7aUFU]^?V}멳oG_>#|*~2, Ԇcc.~-wqwtT\oC1kUa|~O=UÐܺ(9]WFQ&+x%W Kspѯ4H=tt6zl|T fskyqkX}j}h7S4?rw}}?#.|v>O0SZ6GLcSoQN> ~o8^\ Kx>+SgxO[YgmU%wGaYT42dQq ˣpzhÒJWj¯q4\Z'CKU*UŨFȠcEq!8cqp#6Xx']BTE| _W0131 ?q%~p5~ƪqn-1$u>/'R ԯCծll(ϳ}]0 xxϾxoHǯ‘5ՙ7\=f_[u6uV']?}eՓ\1W`*~iMh[,Xa1x≰zrJ< sx6,nEPFцvl Kje7]q<$ҷasLkI[Oz֓^<?pxU6+bsWcZ=\=\=\=\YWU*=SgJL)3%zzzzDP$>9)3'gY_ں.DoMԿ7Q&DoMԿ7Q&DWղz5Qk'{LjZHԛz/??ATRGD}}zC|~Y6uWF'Q/wEgys>HφK7AU<:ߨ3ݹBH ,TX*ԥHRT)lJ!BM(&dߙH7wʙsg|g̽m(d{ z(-C8 F# (ZwW5ŪH[<"N#[Lx8%Yշ;ʖqcYۀ^qDHR*8pA8.;PspLs0oRُRep{npFSBgO =:y*TީзS_0FI|7oLnwNf OgQ,[BuRjzZtDNIt6:^cH ib5b y)5-1j%#G2iG)(i)ߖɏ3rwA aK̑`~|JrKc 2)HYO@Q̡hM}Piz{@ܥr M3#\s#BG΅ 9o.w/@eTHYza&XwYxLH\} =ZjAfbQPE?^@үۧ = OQTsP< >6h*Ъp z%xChxd4)Wi M]40vl&P05v|ā l}][GCxV!a=)RaM Y9EWT&k3Q'z*l WcR֣gKF@<5yйR_2fqŬ`m[h6Jt-^dwhqtl<&ktT l*Hlhw<̿ۥ-|"jgcjCPnG蝘]NH^Mp51_ZIci5IdY5V~c|Zڲvڳ[i:n֍uLvAY{u:3MYMY>`5l1Bތ_̚kίb~5o.kezކ]v®;XkމwbnxOޓY[އ`v8֋`46J6=f,?s<o}'"ZIJ_DcKDHbKE-QuE=Z4Zq8m &D4eE3ќ2MW Jb;U*KnNg{ĭ%:{X%zo#A_bMng/y>Ee5|oo3_K|oo'Ƿ !wwr :ʉ⇝'9N'Yp.r.5D .t8O?DgEw;c55q3ޙ s&;E/g3Uvq;ӝO#LgwÜ3BgxYcZ$^s2]bo*R\J^]Zej%VubQUlT7EU*mb꨺CQDzHYj*N'SREQuX5AMD5IƩijWYU}ʆjZ)/TyVe;խ֗wsm&-d7rm嶒׻7n[m/woq;;;eo|}rw|}}Ztw_O/#Pw;J>uʧqi=_r;ݝ.G3E{PtQ~r_*r?YNS:=='Oz3_/09'|C9?u'-"^f6Ác$K N\<{S^g\~Q!Q9o9U޳N7{IF{XU7Λ4y:{y9YZ++7ߛ~ryx9r[tzosw; {`//Dΰq 93!7r ń❑PJ()Ty5w&9BOu&^r Lz8fM?BSOBSC9xT37*60ZTgqԑoyWUR Cz;5;_Wb<gt'YߎH -]:qr½Z*O}U$d#J7tktF}zQ󟦄2ћuXq[@o(Vnz^ɏ;j+0}m snj%~<6<)^mz-hlĭt|5mz^ @o/z"~å tB);O3 A?^\i)*z*Q _eTDBPA PPm[hw~bc5nVFiJ;nml4p4#W\MRRez<ͿHb1+ʐO'g}wCFg6v+߷h>ᖉBmQrQerGVV*gKt`KNooK,!O#5q6*廑4?RC@CbWm}HQN_yzO?EJNMm08)'nψzT/J DDB:eЇSOIo8~/܉ԎL(5}3o=tHI?{G[/ sBH^Q;fav8QSМt1mԆ2;Xw֝B3<0Z<=qi_i(w|MÍnN#a~FC/ݜFݜ@7+I΢ !M9S$j/39юߌNGˌNGMf`t:vlt:J3:0:2:6:3:A{1Qיt,t,tFcUNC;·6Y{W>uzn˭Vf=*nUMrd7vأn* ^p6ًlѿF'bNĆfOMb6}{keF`k]m2ltntl5~klkG\GF<*JTU:u=UVbb<2&MC;8K`yr<9u_AV/- !e+1^C1@ic鐹ZAMա81:A(YJd+Jg%҃DrY\nxo|BUyOyn嵚+U&Yy5TY`OqZ+U)Q!qVA;S} ӬL׀Lo &7mvA!3)(d6%C0E#2jzVkYaVk@8ZF]CR]C!mTUmIv'uOnBޛ[ 3Q3ꬺPꪺR=սEl/bE!W/(]AH_՗j(?DO{ P{̬ p^D(5 !h +jBƫu:B?)`'LTkj*LSӐr H}zX}\} >g٨9jN-?TA2 TZP[6QڬQ'[Sjڃܫ2RY(q:U6RR{XFuU@:9*sU.UV' W+m_Q&Mp 4h+W @\&Ā&:N` I) L01BȲj PAe((NVy(mSe vNŸe"}4}Hs;wa9Eqx}~b~fY8g}6.~f;R_VO@#wȼ4လ@,E\ϏЌ3w"uK|eᙸEF>D]Mn>ݼGo~cc*mAу*]z~[[uO/a4z<_Ocl2{fzrȨ=f^ 2s/*EXؕ}\vo8]ڙfC7..(uŵo0-D޿#UӶYts7-k~O]rי҃?x_ ybޔC!ܼ3+Rj~h 69,s[]Üc_I3rU9w?[5r)"\9CߧsLnY(FKuh3~ SΈ&uڂ=vh]FuoOӿ> Y>g¿%_e*t4y1k|TDkzvw`D4Ѥ"+J޾S松2|wK6<-ػ8Ҏ(tEپ,!EXfp^#GȳT/k^j9np`9-9;lu]?݀wztI9)̘.G畴Q<)l8=;2d08jw${f/ѷO!+uUY1q!?\׽SȝA{Zz9l&L,2jxjl^6,>D̫2a$Td-H\߇"[l׏u&y "?|]-wSRU e{*yN͠{ؼ0fGj=ԜF})KOtx\ajN/mynq.64]/t^oߖ0=vƤ-\jhGsmӯn= g]țFL>v/(~/We|+J:&<"FR0GZ#ka'ꊺLY s*EsV墬UkU.ړ,:N,NtXV%o,X}cYrh7v*8_"{{cl콱!j콱'7/=ol76xc76xcӌ76xc76xcK.slƙƥ}ƺWƺwTeXc׍W6vxuc׍1vxg72Ƣod8ƢXtE7~48>.\UI7nßq8&n>ܭ/kEcq4(ۄ1vXcwbV|0vcweI۽ɧkۏX_kc}Ow_p_3ܑH;?6'X__k|;uvܕ*]nt=*?b3~Xe*?a O'&*k8 D5SSQ"oJ_/o#ۋw)rcM\i6q&5ZxXk/o#cM|)/Zb촉^'~iyNNTN ;m2h*NnNL1v4ou$ML#ҀzQ)U)(㰤>^]:(^F0 bFYČbކ\]jE=WC`UԏRzg<(y6Q" (J_Wc1Ґ5Ƭ;s?Xh =7BYrSM-.<CԌgA u5 (jFb6ĢvM,j7j~`?eG3]~h΁pXL-XL~ -_b1:0}?P>j@k[O+`}ku?ץd='B@ZoOsDHsEHf$#5H׆ral f9L$> 幘<`q6BgLˋxKOb$ cJy)g2E83+x%F>˟ UF:/qί/ບkK܈71wjnlwpV8d>p~Z11Q@l Vx|5)8M|eop<77Y#FV*2`1Bq|Jvw0NClwcȟ}3~[raɊ 򣨼cW9Gq>8Ó8S{=OsC!.'' cnùwT1l&8&TDVOOb)\fOgOrcU%}~{V_/B lD_?RezxGJ}%YWa,,Kd h3RLP03ALP03,Ll`&(=! }0ĦZV,ϑ`/* '9AAN\{' [d ~fiCPEȠdecy`eVHJ ./^HYJJWPy3e5򵔯ZӨYi!xIi(xef j:iH:͟TT?ȸx.q:<"DS3ޗߣ{tߣ$Q~{R(GG=:Q~O('{tL=(@=P~O#dԓ)biM& -H $U?P,Ƭ17ԣ g@,C "D9]i~j45?VA?O^K(%' 牿_L.04&R04 蟓,-gE??NgHIǥ=G%"Lz_z-Xat_ԢJ(} FEV(]"-/H)G'EC]SCG  }{KС/ҏr)(/!9!41q)qqS´l'<2!_L_PP~QBl&3W$T'>?PL~੄*xrX@׳t"L"iD gA,/Xq}L:dJLIHN`.992J'ГH%g../>BEp?'B???T0}1>^L'O%j#^O%:#.gׁ{y1׍Sx/r^̭'[[%N'Gl=z u&T|_ hRs%s_ע.i"9|=_\7+VpiDɯ.%((UP4b bY?! \N<((yQr-?J"JC\N<((UqW5TWW TAUDƳ@SL\MLƼ''Y>'%ihpfE3P>HIʔ*gP/x$lLrș(c+I)'?(`H٤9)OEMZO2 2X@)dda,|,ܔ\l8Ky))arb‰ȉ4e)2G}$uצ r_3S֥C_$Srე\XDɅ\OɅZv=;U3.B3lhN4Wc+^U(rUhkF6mAێ m/hNF;ǤQjxE;ekh70,hhhYhМy-\:>hikE?_gc-_Yj蟿WKhWno[7edžhWYqt[Z?_W գ^V7öy|miB[dk1H9]ޝ]՝ ]۝΃n.{tZ\jxx ^VzevoovGw|.f{Z\ M޽k+lޫ&tU*3L\h fZ*ͥ݇TET+qZ 'imi5Sǵk<h#t_.m v߹vnv9zCY&5HUhJБJ`kZsdN/ꁭjy GZ.jGu]ժՎRҊ{alzG-tc.tñ*o`a^>uPoh-}Vް`XuN?LL]'{zS:ΨIc+WCCO=׿U]$_148TuQ5_ֿ߽ToTbPﺢ;GT!u]ZWCjR?gYcWTkh5˺Ύ[Њ~TD}hذҮU}Bk}ICkI17AhGl_.t+Z}e*aUm53W._5lOP 6':|:h7O]%*C;qfVvsՑ鞮-w^nX[Bju@M>t Cw[h1[: ٶWA #C2uWI͟E}ᨽRqƷM+C';|;FꁎPߞ{+C[лQ@w ;NÆy }c&}z3wƽ~zpվD=Y0iWnM3cԿ^q^wlrluP/[݁#굖$>ɤَ55p;\@Q;-g_9.B+WՎW1HLR mB$dc}e e gB1Ͼ&3447a)@S A=c-jT. Y-+{A4% +-z1~CPcX>UmN6ҝ=QղǃՓz@~?iY=ڳ:ڳzgĺ-zgȘӳZc?my^!*c@im9o=GJhB􃓍zP1gz~kz%hfUhNh^mhAK.e4fmKroZLFFƱZ3;sF~;OY5:KقIfg9l,h9/:5P>:,kUjNk9_+QusXF(֚`u*Y-o]a}%X:t68uӫiT۝g,$]|cs!us'hJ87B;iŹY6`O+骭z Z73|.rC:{ 9siD[)̅Zs{ ,J7GՅ皫ܻOIs{/w*57hn /Txypż},l5'vq.g6Of<Xv3{++դI7 u_fUЈ s}-z^X [S7ռ}3㊫6W`>]VZn pExy'5N8{nx=+>恆wy|y(Pj>)aOE|Ou*|tg6n1 O-VjӞsFbŁtϯ^3=- 55Pkw<.E·:MΎhCc`>3H]0Yl ֕5*Ʋ;7 ,vnX7a`sHf`v+3=Vֹ`W+^uc硁eGǪ;Gptؼγb ;/\4p_[yc&Dvژ_l/:l?5氥3b[?+q1ןw:)lyز˳ⴕKṰVvlWVvgu*XGGiXoT؆j?_{L[=ʹ;VJ^1=]xBU.̿mA,܁6g6VOۼN_SlmkQ*xj8()ZnpX/BcQbjmrڶ^cWmG7Ho ^Z$R>8mR%'MT.ʹҜ4"1 cv=+olwryPKKrAqKHkj6vsp|"\۝.i0*檧R bKt>"ծ2uoW`zk`5F֩,'Kށ#zvXR=֒YI2rP%3,toL{F;igw$R)T`/9,=#ŖZϑHex9d'-ϙ5ԑk {Ş&KJds=0fznEX잻ixNF X\}ڈ?,HYfMˎ˅D։gfdf6hY@l꫌l쌯)}u=}"-",FZ- UST3fɾȨL#r2牜5Zžp`J2uW|9oT߷2싓[ۄ5K}"WoCVmݾmỖ\oOؚԷ?ʬEurѨbUWYs=gfZFse}yʾKBkuhF:veB/[xhMvx3o^t-aoItu@x8=no c~"IK~=pr7s]vǐr5d!xMLbS44aL&450SIø8K%%K,Ez@Ҥ,i(JIR8{@-6%>%ӽȲtN]/\sCS?Ϧ6.f!7S©GR^MNl4&,-`-fbo+l%UcfgG4I7E>դih4od{)E&[Ӯi 54k4aͷ4i~ Oƣuiݚ>mPkiojoi i־jkwhݭfgڟiViM{54oii4^Q3Ϛڏ|[fnn滺tw5[iNcq^?+5|ʟ絒KKlnNi:wsUz47Ks_NHM|;_zǥ>OKN~#~Y%_)o2=ӧHoHo럖vm}~tEu[ Ŀ0Ecl^r%?P?Po /΄_N}'h2r_o2Z˷߲Yk_:U[b\6_-hWv:3È8F"FHcD1"JӔFJCH)Ma9̙yriH)Ed4M)Ec@Hi"EDR"ӔHYH޿s& !V}kڵw|;|>zJ=,V93 AuNݨ[ɪ$ _ F>>>>> _ _QEjQ@:L-w#1XuZiLգUUMsbuڤRתfu]mUjzX=+Iz^#Ո1b[$?R)7H]d8-G*ԫYTE#vb)zB$HmH*2/0$tlnSY s2$HbxPEI?(UT&ƒU$j1.wP])!f<1d Y|FIERyD?Gω{IH[H+$WI]$HJa?$wE=Ix>qQ|H},,HF~b?žJ|~KX|~PhOV>V^+V>V^+V^ +V> V|8AXC0l >(l}$l1(֍b / ٲ² ˮ#55<UM[=1qJ~ׁ6YEj~\UbU E(jY2?@Y__H\VKժOAujOJx2JY_Ne::0j]|Mf-ʶv5x#֬\({u(ج@C9?'Ə1brf=C9?yK8? ] \\w b&J*#,F2bf>6D-aO>< a LFl~f[xp[ "`Xbx4QvF&o˜DeOTkNL OKL 3u7} PSa"V>AygEi$=Sցs+S"kRyks֨G'CS{`mS0hϱ2y0l=R<7˼_a?db>d?[="Dv0xYDvǛ={$ޘWްGd}c0r ʀ>[CO"DJq<9zөsTmRʍzaKoɏ؟"WRӢ"5cQԒ/~E8@I->o^~_'7S~^s='ahijAtdj1b8Zju~Eqp0ܯ.]l9 ^4M?Ň:;skNe;h}fRqqΕͻrr,+6[љU7'6cEQ5̱(.HmaMm=ea#qi=ڔ@yUptm#ߢR'9FDSg`SncT7@ȀrjOqH[>>=ΏLǠ3"Ě hw,x1G+*`MWcz[ސPPX0<]P69>QNPP^^g 5LOhKjOk7sBC*a^zoXnkX۰,s@ܰ"}au@xanX>ް1}%}ak1ֱaG"ε/C53RL#A2Cf:3%3#x~.gF#e*2b3536(356$3~(#V+ȱz̍b ֏$6.3?VYsf{l5ݣYmb32+N$?_P: w W+}igM!51||U_ԗ---mN[k۷׷wgepwܗ)Y__%J8ϘjOY5~v{-ߏh!۞E1.{= [$xz/ކmhކއm0}oC}oCK6a-##A6oCGm6tx_Dw_;Ntމ~Dj(4jw5x':DkNtމNԁwNw O 3 w_;'6t:yׯ^3Nx'---'Lvn7q#уd=l+9Yۊҏ,e3c&xO~+L֐G@MdOl%Gv5,W^J+^b yaucEf<胴1QbЊ-ÆeeXG#NQï ;HaYR.oio #c"e|oxknMeii %jyw&"oQ&"x,Vh]bMޥޥrq"Vf]ЖvvokV{ti-VoG^=$F{H~'Y%gpuvo{ڳ3=I{{!L}:h|W{-{ĪI3_>(9"@_ȧ"yxVg^I(C*H.|qUψr˓Ay:o\XRM\+so쑨ʊ6ޓ"d߾JnomMe͠,'HX5Ml)Jc3N_|g$X_Ol-5-{|+FzF&d1;@=fo(=b}GwwtbDh b49/vcPio_x-B04M1$䭪~Fw.{'Zw&JfU] -r;/oտN3W&WSVI Qb Y ϒ \M>j?ށ@A(0'iOrsuGHp)$t݌]N~5ܶt<<<,cB+Yƌ r~x)6<܎'ymyDΛgaȓ>w- '+8UvV`q3a'`{ݷ}}{Got<㴎s&ԎՄuT"\:^twHa! [/L >2F˜[}XO@Qܷi}M6kpNRu$t>]xf&-t/:t"}Nh{}gxtI;s8O:ѱx:i9{QpFx= _;Etԏ'>P }F8jrwnK=91~d$w]9s;>Ĕaݷxl[; !_zcQ^/5X+;hNA{c6^N}H'K ^ZOE͝`瓯>N3q Ms~:Z=%N98+X6}zC}h+מOzn K='f#[Nc?'9irüok4r>Lh9W qmpC|H۷zU6V/~=ړ9ior={I=&hrnѯ;&>q9u|bxZt#n<'FC-Ths1z2RzsN3y^G⪦21=L[cٶkskX*=α=M&}.dɤo2dI66y?re8 ]q/ѯqW aqɺ䦜r.Uz޹;9%71㹞wX֜9[M~<ɱ'XhvL*_ѯ0PF('Tr;a a:POaa!a aaa5aa#EVBa/a? 8~O8^$\ azkB޷NHc" !k=l$#T~YYW1BFkOXDh$,'$!'l"l֏r; z9NN_?Xcv..ik)X?\/\1{}Vm}׏&_8jn4LTG1ױرXXhvlqlw:8$'gݎN9@s8.#)wVNssYhv;(rs.t.q.spvsnt8;mν΃#SγNEe5srqJ\#\]qST ,R\1W5ߵht-wk\]k.H*$:@CuN#r]r]q H{=}q_\_\_\  ŅAŅ[ ؊l{mlT[\LlO mimY5sWœ]bm 1|^7rYtT52::(S-[LQxvޞVZ?ӱ1-[$G'I΁OۻH.ٯ8cc1jK11~11|^iD~vxh/mƆaʅd`f$Km Ͷ:la1Ԗ%Em;ضOb&Jl^:mvõoJ_%Iav;Q~ P%6P_ʵ(k>\(ԏזC4My46y1B>(GqF*} A.lY~uNǵsNqmƠx$#Q.*Q<P8K0zR\e6<,6hxTjFh#C0>w4>b?k&6fP~|̜ ^m Fh~ɏϛě.1eÇ8O@mOTo^'*p'wrl l2$yރf/h_Y^h@-e[q|D`,63l8ʡ<ρߦ(x,w[.~^Dg-*(?Cp#-VCԬ֝;-FpOBJhl[ϣPnokZ.p5eVdkyfa6mLG?SgK/c`X4܍u~6m5נ4\k8{5Vbryl K8X[(@9=j:Xofjf4y}Bs9Z$ln^/c`yמlC(?:@?X47il~+:QeaW5L\CXC.Bz YK Ө+x1;bZ<䖆gllA2(?nc /7cūoφTXvrRe9v3ہv*ZG.үWfܗNU&rάzL^GɷPS>nEs5M؞kh؆9:4/ge.y)Zicu_Kz ^&Y$-H㪝},kβ; z^ǟgВxA.[;wx mYP.OHoh!4D'fv9,|usyVj/Q'|я-|)Qݏkp]V#~dzaƜHa}36\rۅQ|X<D7qM1rOQ.(w5QJl0}ۏkaJIeU86N3x44WaK2ۧT>m^Cg$LV7TpVF3`y J`$-P!QNc/`c z|,GV*V=(m4豘WqЭG*s2!m.[G+`rB[7yz5jƢƭe\P_2Clq]#=Z(?Y.ftm7KNΉ9:'BD蜈YȚMT {Q~y4_j2mUBT|}j~ʫt>n)L r{P ͸vDR㲴0K _!Oǽ, 3SufhoYCo߂nҟS&} 2MDF,D˷P^kS1R&OB-gq /ꌵFyf9\C` ڱ-~GϕnznMď4*~LωEw$M/fǤўrc΋>kȋhk~ޔ(mI~^p_݋Ap=ynM'Q,IŰF.y#ڌUpKwDYهpv0gZqd/b3qvvOL둑.|< zv =gs7}v'(/ڍ=r&=,]nwY~2OB/ZA= -F0kx -⪗kpyCf@YgRdpϫZ9J!Qtn7I!~&y<փ`^ۼ^A93ЍY:nn/YzXs\c=v'%؉`47f⠴}c(Zn'^{,OPyכ%K9!>6K?nGD@^ɮ*K;tմ#0;pl -ۘ­O[?f3Ez2`<~?6!=KWAϯoSIx"=ԇg$IC |>;,]cD7*?#K b{NZsg_lNN[B"R.I%k$KrTHE$$Ir릛[[BJ*$MxoZf}y|]s̱s̱g? ON̆ăzcOB~;}j$@>{`G83qBYtؼrrqXo̘TA0Qױt"& \yZX^#RZvRH ֓\;bZkkJK,3u7z.-zms*wߍ?Go_qk8Wm]=oGgyy;Y\㦨_*w+1k]jډJɍԙD/*|\=<^Npl\={zlWN~1_2&2/X[4AsTDwm;k[OM8bݫq_ R"t(J_yޏ}wgs)# AAIGC#˄`~ʓx]nNs޳ScXޠF0ʼn@k_>C^Ak.edkd9{cx+ -Z^TCħ$0®53uJWeM)9II$s26;IzWZݝHXw+>@=T«"*<\X^j*hv뗅r|qրg^e{c9g,jx}EDszs\ <+L B3ͮ1W=> 3=LjsyޯYW#n-CDb]zfF}p6/p omjrGlP`ru,q0[54|xDi6(ʠO9K1|lbC"ީ/eF -<}e}P?ˆ^BqpÐ#G}!/wbyD|MN8BJESB~΁IJ~jLW1LZSh8!#~~NrlZ迋e\4 Ѵ@ΣWe}p|e $,MVw{9ERǬD^`EdSn*M 83ZPpNRߝxMx($ =j'\2Tw}F7ɶb*#h26$4h.PJ$Yp/g,a-2qaVc䢬('U/BԻϐ'+eLK QF qzNgFro3_;VwS%hLa㹰 APD_Jl. ?S-qYP+To5^1(svE+L6֨zhmD,ڿȥ*W%/ӧRȃ3yҰM+2$qD+靏gw1'^3J%JI˫H9+aaט[i}O9̬pS^Q31k#gj73i-s2Z© d,_ }#>'zy{%ʶ}@U" ~JWG#!X¨rOгQuȿp㌮#6iKD?"S 4X,6quȑ+юT2Qj6) {{ Q 7}{п_ 4GDzF vtw)fp{^yK)n Hz{DrAZ#'tD.ot.ud vDG*߇7;Ξ$72zTrSd wjyNQ]eȨ~* OUͼi3_Go-o䎌O[gGܫ򙗾?~y]}"a*ك=f>_rMp4z0\&}邇ښ@.O8 S,]qsF̬VQ.~_ovYzW&f28tP2,\*k#?vRpFTVˌg}M3oeF,_*>llz4f3mz zG0ôڠoSGfi[*{{=ezj7xYV[;c5}/Ӫ?#_}_?ޛ+<]Gc35%8;%}+rQ,}͊N~ YXS~?4MB k Uq1xh~IT^5`Iy|/f euOp4=U/(~q^t;䉰ݺӑ{'{_HG"?Ḏ?-B+ /F 'x>|asx@i~ aJ?,+6A }h)+EYG=GvhFáJiyI`3 Σukȿk虑9CFx?~e]de~w#f<~4/cȋw`%z=>Q985R9@sh<f-z+%Z5db8 >Z(SJyrŇ_WF1Q&E8`#H#IȺp2\L^uet9rx e _K~/6`X3hoj1iia&uE"'ieUs[39wp}m0V?w1zvYjoQg28z0gDy/ V4r(/kj?ȹ#_rg 2l8v&:0ʐYS3| g>i ܰ"` 7?TT0rp.6"ѬC+ҋ h96OC ad̆hTdEdO#u/ىp=kj=5*jOUz%3ȟ^̓Ԣ}dGU΃֔u7T\27AޔT" jiѳ=H|R?- J#\ 3ПV|MElnV&v`Y r7NXC>L)\`.b>B< C3UzoL{OIpk_C^oDόF63,"3/gy5yo=U/@^<<>+YG<9^l#72Zf^cxxf$2læ,aZkM/FOQ[QnB?ϴ>Y8YEx^K:G >#_Frg 2Yl8v&:0Zӥ)D/Mp3CU79BS hG{ƞA|EUd1uȻ9;`p(ȓ0hF˱I~heWo c6TX|Fb݃/ `=FI{? ÝYSC.S ^p 6duUJ's$DHl&Yz bŒi/ElveQi}w/}`f$3ocM~?LY'^`! *s۟Ƚ`K,9oiFYgzo8m>EiS<M/ZBps{E:-O-"5ok_/e䣙K6퓼o))|f+3 ճ&NQ)U/M-dg&|I#B\Gߥw!ߪo;yA*_KWno:?m2{2S#|=W&>,W99:MaثL9O7ZXˮ̞h̉ϘsїE_Xr11.)/Ʋ:~>kiHd")Zo~gyp1\wpշߠ;=p<“0 wu°,eaeXփ`3.v_a/k@~P8p"| N\h[p1\Wp3>~/GxS?!0fҰ"=p`ZF9l;.cD_1pX'1Ά b vp7 m`0<O+S| Ad,êvdJ}6a;x=w㾫=Ѹ}~<~8UUI xɞzYOҸ:W\w$U?f?MW}>?s4XO33Sw*.%E\$]K t,'箤<&sSm丫d-el^W֫5:x=o7ٛ-V{ۼ^60?՟/7)nLeд6M3̌7S<\QΚ^wzB׏u=NI~:ٯ3fߞ8f_|>^w:|:u^z/5\|jkkՇ" +.犻ZU>nx+׍cQT,;u5:VU];^ozk>x:E~eNu:{|{UlѺt^4m7:Ypx׊"hefJi//wXS>`0X;԰xS>b1c1S>n7ud;ԵO٧Evb٩vNL};0L;4,smgFvc.s\γL.0Evij_fܾi4ms}׾kKR®+LK}ߴLkƮ1Wuvic?G#n5cig?kS~f?3v`? ~m67_/=lQ{t6dO_M]_BS)Wjzv$'R>ii4g}v\jIc}^ r}Ѿ(MK%if_/v/BPWJ}]Zvoٷ}Ǿ#DriCrk]vFWm]`*nuUzUvwdwkƍvftn߈bCr=b-=&8Ͻ+ORk+ SmggĤ6Nm&\o7"*-ͱ(Ǽ{?_+5W4fZKgwǽYe̒y,UA.VQ^6TL{8Jqpڽs4cNHFqv!i g7cN=qpCsn<ǜ9Jqp#=CD9i8J{'8I.k8(mGyL{*qdđy&82Gdž#|YqD^#b9qD^#27qDYGdaEqD^#2` "27#Z㈼Gdq7㈼G8Wލ#$82,#"{qDޏ#*qDVYGd]qD>#!GqD^%"o)+3"l#q-qD>#imqD>#=Ȏ8"G8W#Uqd#'7qD#7qD!F"$S7#SqD~#r /qD9GHqD9GD_㈜#8"9GLd+yQd%LE&ݏ"nHD\"rJ3EF7O:I%oic1m 4skƙa3<5ߙ{`~4?gsbC9bc&/XO%oŝ`u\%ikڊ1=LO Los$3@RMɑ43 vR 7%Ì0KAyV%fdE~piX2AS0s\bV5fYg֛h6QiyѼ<l.ދ.r}k~_/:uYjfyϬ4U?Zc1sf~#,p_1:nru꽺d?16E?//e< C2Vƹ}L_}L&$˟<%OygeL̔]xAfˋ2G^e,E*,7-y[ޑw]X*dd*ZZY'CWG>I6DzE>qUS&v!;sWc/+-_Ud|/Q~rg9 A9$别F$W UN{UEҭ[U}ԡOdI`$51!@s<1 Y1Q0+bD.s޷޺}z޵oWF*B'TJ1iCڒ`BڑH:Τ J$ a$DHEIOҋĐޤKbI' I%uAn[6&w]r'C<&OHyJ\N N$y%yE^7-yGޓ|R@ RD>O@R8sZr:΀kõ傹+׍q\?n7Mfs V.vs?sgsyWw]pWku7w油;]MM]K˚+k4747545ٚ;{Gǚ'S3M&ORJZFVN^)j>h454Ś^ӆmLЦԏ646-hKڊ4mi0h{ځvhgڅvhwJ{0N#DA %}h_KhM\BRJZF>}6>,#Ay2 *י낮sݹPt-.K@Ơln7 p n=b[9..=eƈ^F`sڻG U~EB8)O6WڿFUo (Dg q<"IZ2G6 ؾ*fA}]< ^a>aT/]=PoA9zF\=l;5:& Po#FHoX#+v !ے:?8@@ H+d /p>¯%C-=b3i$0@ 9fdhi:Ɏ*:bcD G~E;eQ!{2w(;utƱqe8>׶OU voqS2Iƒd*I撅d)$kF U%'TY"UIտ㿏,Bݍ]P6 }OYIgW7[b8x(\%;މϡpH2@(2M"cD4L&L2BsB2@g9RN2Δ3E9s:Zùph5A_beoW45S_[<_`+[kvvs pmv v.Ӯڍv8nҞWWpwu>(m pdMݴm:;y< g|u~O~O3:?E gu-u-9].uu:: P]kB^[Hw@ pv=b]CILGFSHf-nf+.p=6~xUPz3UL[?o퇭[PԻl3xv>pfK iex+ޚmy;o;yGމWUj|uޙw]y7ޝWxޓ/K2k:7-|g;.!~'8?ph\>Wr"#+JOi@a3krl lh窀.H/z6ĺPTHB-ȨC u~1bzA1EQ2CCPdFA) +l5Q+dcwTavFlU"/2<U#ӓdTOSQu<D.0S+‡;>O |A5|yތS7gN٬SsaG?υBOћx#M16'́1%m1v ' i8I鄩L$ 5HX'lD*2 7-.=\=!'P5@4qq } Մ!G ?D>[=FsPmPF_uHׯb.>jđ e4L#i~Q[?d^z1T,l 5ўXQx,3!R5ucz0M> ?XYFuSu3'LTHϫ#F-2 [_?#;}QԅP{Dl̳~Ѳ~_t_ vCY]b}: Hd,alrv 7dbyJ(@Q!&X` 3P`Q2`N4:Zlg@h1<À@O(\DZDW8eGJDE9 0 2!CH Q#uQB0): c-Y*XD"( ͇,BQ_q`W|vbDVO3C!!C6U-rĜXGR #('dQ$Wβ.{^#זFr_.Gr/9VAy&Oʧ_sE|U.ߐKV~w=$84o"7[HĽ7S|Wzh5g/"З(8zMh IҞt"]I$Īz#5ul|[|\UE]#ni⧮}S\մtxM-W?)KߖJ( +bPR~s17mϺCsP-)Q*ȿÈ@M)͈9-sZCۆ8@"̍8o:3] Rh m7gYd1%^5cOq@ל7QǃT}! q?>voՃ=X}b? !0 2dDW٠}!_WAGǠ}*gp&KXQِV-3 A;`Ap_bA0 q8f`A0 q8f3Rz1̘fL3&`D0c"1̘fL3&`D0c"1̘fL3&`D0c"1̘fL3&`D0c"1̘fL3&`D0c"1̘fL3&`D0c"1̘fL3&`D0c"1̘fL3&`D0c"1̘fL3&`D0c"1̘fL3&|y>קتg5e{<%v֠ zLIjX5`!*ZY0\`MjFq)fhSpCBI.WʜLcb iqjql󋽆&[(ɚ#J2>#pV;J >^-i&]RNЙaNjBFEEz)6ĬULDb|$ aI1J8gb(र; U˷3lTlGLRh5 lQETe8&WT}M[ĵF-?oW?ˣXw J$e;X}T2)/dO"vm9൯6t9Q[^:?Op]/qʞwz9i⺈ʋ̟<^T P H65|sV=mˮ/Fhڼ~h4myiÀes|]2n[W0VF~vӗZT^MvԮfu@vU'xaܞnWd9BT'[n2zƆ -iܧa7~Uyh=ޙok">}N[;$`H#b ]j+7w[޷ђٶ5ss![Gb>ѫz[E;oͬP Q?PAJi6Km:q}b-">=O=!1>r@DRfTȌNQ:ju0.ybi4Wl+dB_0hР}ATr$DJ?axUO۔LM(1=yp}Vʚf-ti¹"}Ͼ~2MNL]5C߿DfςFWvqӥV4i34!]J>M2KS;bld-%)6W+Z Q,L;3`蘠Ŏ5$VTU* eGF􌃳qS`@*fo*I}>&)H=c'|xby~+NNv]w=m;"BIŸ=bjw9#r1$m:(PJ?|ЯS9onmWIB-~pgWOǤz9|cgnbHQ~7]In>G&1jo|IiGw%ŰYrj->ɬ= 8-GW˘ϱ0qrqщsŷ+'W5O78zf=WxA Y׉Ί)s^36j}%{3=tݡ gohr^XҠuɏ-4Wu'FX2fjl#j}J]ٸ1OW-eucǦoڷbϰsگq yG#AF#;?sb؍ fM=!9oUbs{͙70khqwnk朚hztozLTlPe=qYiJsd'i`r\4da-r[ @JA@3bl( ʓgv9F7;:+sit=n ep@RĘ!jpWj)^JϚ5zz?GU|_7=c 8m:{˲_rSb_2,`uYtU*<?w25̗5 ^N>StK^iqIO^v1ԴMF八yM?VevmKQ3o:)K>2# .eǶt2ԼYt*բpQ;qk535H^6y86H7)~3n;=l,ʮ3vvZiOh>[EHI!y^7@Q F^@ej5h&(FZϘ`=H466TޘU?d]!xn+"Vl4dyZUZE)A6Nm8_'7BH@W&e‰U=oak?fvxٱiЍCڴnIJ&6c%Scww [ۛ-5{nbsOظw)si^ 0i/>hkx.N|0x>Kgz>Bi{k#?|g=9'YOꕌLa_^mQj:w_qپba^([Lst O8Ӧ% snmy-W[vUzv_'\kaaWM~ƕuNٯ۷ꙵQ!)OwZZ|眽oϸ\9eN[}{S-bEɇJ]orqi&o8ӏ}gɚx2zۉƑN3v?pxs멈CK݂6ٺjX]5d@Ewϵ.S+Lw3)/∬GqO?QD>֥Vi>/mμId:TIÿ@<iIH(TY 3Oo)hxMEXɟA;`mx!mӵFaY#}r:߭)ݪ5ϑڭYGC"'észu(x:C\T+>'z϶o$۵n܀ޜ}Sk[=w|"7E:5 ߦ] X dЁ9;w6Ъ}C~?>l۰ Odr8i̬㺹Fc=/no2g%]޵nCJq,6Tq{ C_o{p꜉9$U L>6>7<}f5s*[5`I{]thQѝ8q/nmm/@wm$ɡ7mo}]Ǿi9,w7ġw;e[x,Mc PleٖcX[瞚˅5-Mox֕TIzw0?ե+KK~Q#0uq˭}aۂ\םouK,/kabbf(eHbpfpDW1*eO"~_-?nxQ RFP.n$ioYᝒxx##p5T!UsNUsx/1hrKt)ၤll`Q̘P7+%?Ģb\L&rF > 9 ALdJ  < Ġdu?- RJt&O4R%τz:v?]m)+μ_tԖ n7x&\ltavzJ/U|壗)']l+? .P֡.KV~+Co-{dy̼Ӟ49M {M穮{^텻Ԙ>×ϖG5F>==o%1C֮{mю@ Bu_ӱRȜ)3#/l4}Ӹl^&_uySŇc&MoOb g?}&O87C A#Ū\8$Ža~N.j[9ܬA¼UgX64abd4h:@Ȃ#9y'^@ eEY ES. N'L~z;_1$-{Z&3K|>^aa&&`DGlML@!Ap864k $@2c#CS(%Nbg/4{J+UӋ{x3}nOy[ۃ׳>ľb'"\g ܽiͫlU^d7oVA"ej6Gv{V.k+4mn ff\]NSOƯqS.=ɭ^> endobj xref 0 270 0000000000 65535 f 0000000015 00000 n 0000000376 00000 n 0000000432 00000 n 0000000678 00000 n 0000001122 00000 n 0000001158 00000 n 0000001195 00000 n 0000005413 00000 n 0000005461 00000 n 0000005522 00000 n 0000005872 00000 n 0000005932 00000 n 0000006336 00000 n 0000006527 00000 n 0000006564 00000 n 0000006595 00000 n 0000006680 00000 n 0000006805 00000 n 0000006890 00000 n 0000007015 00000 n 0000007100 00000 n 0000007225 00000 n 0000007310 00000 n 0000007435 00000 n 0000023758 00000 n 0000007572 00000 n 0000024838 00000 n 0000007654 00000 n 0000015392 00000 n 0000020533 00000 n 0000023072 00000 n 0000012829 00000 n 0000012131 00000 n 0000014954 00000 n 0000014471 00000 n 0000013737 00000 n 0000013289 00000 n 0000008021 00000 n 0000012278 00000 n 0000044585 00000 n 0000012304 00000 n 0000012481 00000 n 0000012558 00000 n 0000113634 00000 n 0000046650 00000 n 0000013018 00000 n 0000113670 00000 n 0000113921 00000 n 0000013477 00000 n 0000121899 00000 n 0000121922 00000 n 0000013896 00000 n 0000199040 00000 n 0000013922 00000 n 0000014111 00000 n 0000014188 00000 n 0000223762 00000 n 0000199628 00000 n 0000014671 00000 n 0000223798 00000 n 0000223821 00000 n 0000015137 00000 n 0000232099 00000 n 0000232182 00000 n 0000020091 00000 n 0000015737 00000 n 0000020279 00000 n 0000312104 00000 n 0000020856 00000 n 0000023395 00000 n 0000023825 00000 n 0000024733 00000 n 0000023942 00000 n 0000024072 00000 n 0000024199 00000 n 0000024329 00000 n 0000024463 00000 n 0000024597 00000 n 0000025238 00000 n 0000024952 00000 n 0000025306 00000 n 0000025866 00000 n 0000033351 00000 n 0000042133 00000 n 0000044232 00000 n 0000025774 00000 n 0000026804 00000 n 0000026880 00000 n 0000026960 00000 n 0000027040 00000 n 0000027117 00000 n 0000027197 00000 n 0000027274 00000 n 0000027355 00000 n 0000027435 00000 n 0000027590 00000 n 0000027670 00000 n 0000027750 00000 n 0000027857 00000 n 0000027934 00000 n 0000028015 00000 n 0000028096 00000 n 0000032848 00000 n 0000040826 00000 n 0000040908 00000 n 0000040989 00000 n 0000041127 00000 n 0000041220 00000 n 0000041359 00000 n 0000041526 00000 n 0000041609 00000 n 0000041724 00000 n 0000041807 00000 n 0000041890 00000 n 0000041969 00000 n 0000042053 00000 n 0000042688 00000 n 0000042775 00000 n 0000042854 00000 n 0000042939 00000 n 0000043020 00000 n 0000043098 00000 n 0000043180 00000 n 0000043261 00000 n 0000043339 00000 n 0000043421 00000 n 0000043502 00000 n 0000043658 00000 n 0000043739 00000 n 0000043818 00000 n 0000043900 00000 n 0000043981 00000 n 0000044077 00000 n 0000044155 00000 n 0000044339 00000 n 0000044416 00000 n 0000044495 00000 n 0000028433 00000 n 0000028513 00000 n 0000028694 00000 n 0000028774 00000 n 0000028952 00000 n 0000029032 00000 n 0000029213 00000 n 0000029293 00000 n 0000029471 00000 n 0000029551 00000 n 0000029732 00000 n 0000029812 00000 n 0000029993 00000 n 0000030073 00000 n 0000030163 00000 n 0000030470 00000 n 0000030639 00000 n 0000030808 00000 n 0000030977 00000 n 0000031146 00000 n 0000031311 00000 n 0000031476 00000 n 0000031556 00000 n 0000031941 00000 n 0000032110 00000 n 0000032357 00000 n 0000032522 00000 n 0000032687 00000 n 0000032767 00000 n 0000028199 00000 n 0000030244 00000 n 0000031637 00000 n 0000028340 00000 n 0000028601 00000 n 0000028859 00000 n 0000029120 00000 n 0000029378 00000 n 0000029639 00000 n 0000029900 00000 n 0000030385 00000 n 0000030554 00000 n 0000030723 00000 n 0000030892 00000 n 0000031061 00000 n 0000031226 00000 n 0000031391 00000 n 0000031778 00000 n 0000031856 00000 n 0000032025 00000 n 0000032194 00000 n 0000032272 00000 n 0000032437 00000 n 0000032602 00000 n 0000032967 00000 n 0000035323 00000 n 0000036701 00000 n 0000038082 00000 n 0000039454 00000 n 0000033108 00000 n 0000033186 00000 n 0000034514 00000 n 0000034677 00000 n 0000034755 00000 n 0000034918 00000 n 0000035081 00000 n 0000035244 00000 n 0000033271 00000 n 0000034599 00000 n 0000034840 00000 n 0000035003 00000 n 0000035166 00000 n 0000035549 00000 n 0000035714 00000 n 0000035880 00000 n 0000036047 00000 n 0000036214 00000 n 0000036378 00000 n 0000036542 00000 n 0000036621 00000 n 0000036927 00000 n 0000037094 00000 n 0000037261 00000 n 0000037428 00000 n 0000037595 00000 n 0000037759 00000 n 0000037923 00000 n 0000038002 00000 n 0000038308 00000 n 0000038472 00000 n 0000038639 00000 n 0000038803 00000 n 0000038967 00000 n 0000039131 00000 n 0000039295 00000 n 0000039374 00000 n 0000039680 00000 n 0000039844 00000 n 0000040011 00000 n 0000040175 00000 n 0000040339 00000 n 0000040503 00000 n 0000040667 00000 n 0000040746 00000 n 0000035464 00000 n 0000035629 00000 n 0000035795 00000 n 0000035962 00000 n 0000036129 00000 n 0000036293 00000 n 0000036457 00000 n 0000036842 00000 n 0000037009 00000 n 0000037176 00000 n 0000037343 00000 n 0000037510 00000 n 0000037674 00000 n 0000037838 00000 n 0000038223 00000 n 0000038387 00000 n 0000038554 00000 n 0000038718 00000 n 0000038882 00000 n 0000039046 00000 n 0000039210 00000 n 0000039595 00000 n 0000039759 00000 n 0000039926 00000 n 0000040090 00000 n 0000040254 00000 n 0000040418 00000 n 0000040582 00000 n 0000312127 00000 n trailer << /Info 269 0 R /Root 24 0 R /Size 270 /ID [<2a3e4748d564a045b9e73f9b8eb3c044> <2a3e4748d564a045b9e73f9b8eb3c044>] >> startxref 312377 %%EOF